Biology Questions

The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.
16 Characterize the role of the anaphase promoting complex in mitosis
Biology
The Living World
16 Characterize the role of the anaphase promoting complex in mitosis
15 Explain the role of caks in the cell cycle control system
Biology
Cell Cycle and Cell Division
15 Explain the role of caks in the cell cycle control system
Explain how pedigree analysis can be used to predict the chances of the disease being inherited by a child Evaluate the advantages and disadvantages of using pedigree analysis when parents are considering having a child when there is an inherited condition in their own families
Biology
The Living World
Explain how pedigree analysis can be used to predict the chances of the disease being inherited by a child Evaluate the advantages and disadvantages of using pedigree analysis when parents are considering having a child when there is an inherited condition in their own families
14 Distinguish the role of Chuck points in the control of the cell cycle
Biology
Cell Cycle and Cell Division
14 Distinguish the role of Chuck points in the control of the cell cycle
10 Distinguish between the 5 phases of mitosis
Biology
Cell Cycle and Cell Division
10 Distinguish between the 5 phases of mitosis
13 Understand the production of two identical daughter cells by mitosis
Biology
The Living World
13 Understand the production of two identical daughter cells by mitosis
11 Illustrate the phases of mitosis
Biology
Cell Cycle and Cell Division
11 Illustrate the phases of mitosis
12 Compare cytokinesis in plants and animals
Biology
The Living World
12 Compare cytokinesis in plants and animals
O 9 Describe the events that take place during interphase
Biology
Cell Cycle and Cell Division
O 9 Describe the events that take place during interphase
O 7 Contrast replicated and nonreplicated Chromosomes
Biology
The Living World
O 7 Contrast replicated and nonreplicated Chromosomes
O 0 8 Describe the eukaryotic cell cycle
Biology
The Living World
O 0 8 Describe the eukaryotic cell cycle
0 6 Distinguish between homologues and sister Chromatics
Biology
Cell: The Unit of Life
0 6 Distinguish between homologues and sister Chromatics
3 Memorize the number of chromosomes and the ploidy in a human karyotype
Biology
The Living World
3 Memorize the number of chromosomes and the ploidy in a human karyotype
5 Identify the levels of chromosome packing
Biology
Cell: The Unit of Life
5 Identify the levels of chromosome packing
Define septation and its role during binary fission
Biology
The Living World
Define septation and its role during binary fission
Fully utilizing ceorgia state services resume writing Graduate counseling seeking out research opportunities relevant to veterinary medicine strengthen r sum por veterinary school Anica wosprod Plan to volunteer as AWARE wadipe rehabilitation center professional Development Improving myselp through learning and training to advance in my career seeking out leadership opportunities at csu restorative I enjoy bringing animais back to good health I love to solve problems by identipying undermining Pactors eradicate them and restoring things back to their true giory I want to specialize in rehabilitation as a veterinarian soft skills Top 3 skills I exhibit according to clipton strengths Assessment Harmony My 1 Skill I plan to heavily utilize this skill to help resolve the many congues that arise in this procession I Experience Additional opportunities outside of school to strengthen resume por vet school Becoming A veterinarian summer internship 2023 consistency Balance is very important to me Everyone and everything should be treated equally in regards to this propession in order to maintain harmony Bachelors op science begree 2024 Education pursing multiple degrees in biology Animal biology exams Assignments Necessary to broaden my knowledge and skills necessary to become a veterinarian Animal biology laboratory exams surengthen r sum Por veterinary schoo Masters op science degree 2025 zoo biology research Meerkas viglian so primary com vs earth sones CPton strengths assessment
Biology
The Living World
Fully utilizing ceorgia state services resume writing Graduate counseling seeking out research opportunities relevant to veterinary medicine strengthen r sum por veterinary school Anica wosprod Plan to volunteer as AWARE wadipe rehabilitation center professional Development Improving myselp through learning and training to advance in my career seeking out leadership opportunities at csu restorative I enjoy bringing animais back to good health I love to solve problems by identipying undermining Pactors eradicate them and restoring things back to their true giory I want to specialize in rehabilitation as a veterinarian soft skills Top 3 skills I exhibit according to clipton strengths Assessment Harmony My 1 Skill I plan to heavily utilize this skill to help resolve the many congues that arise in this procession I Experience Additional opportunities outside of school to strengthen resume por vet school Becoming A veterinarian summer internship 2023 consistency Balance is very important to me Everyone and everything should be treated equally in regards to this propession in order to maintain harmony Bachelors op science begree 2024 Education pursing multiple degrees in biology Animal biology exams Assignments Necessary to broaden my knowledge and skills necessary to become a veterinarian Animal biology laboratory exams surengthen r sum Por veterinary schoo Masters op science degree 2025 zoo biology research Meerkas viglian so primary com vs earth sones CPton strengths assessment
Please match the first part of the sentence about Civil War Technology with the most accurate statement In terms of communication the Civil War was different because instead of messengers they communicated through Doctors during the Civil War invented new dietetic system to The Ironclad CSS Virginia travelled at a speed of Smooth bore muskets had an effective range of less than By the end of the Civil War there were over 1 000 If Confederate soldiers captured Spencer Rifles they could not be used because A Gatling gun could fire Gatling guns were revolutionary because while other barrels fired The large bullets during the Civil War Unlike earlier muskets Spencer Rifles could be fired in less than Earthworks and fortification were essential during the Civil War because The benefit of the new Minie ball bullet was that The Ironclad CSS Virginia was outfitted with the telegraph 6 knots the telegraph 100 yards 200 rounds per minute
Biology
The Living World
Please match the first part of the sentence about Civil War Technology with the most accurate statement In terms of communication the Civil War was different because instead of messengers they communicated through Doctors during the Civil War invented new dietetic system to The Ironclad CSS Virginia travelled at a speed of Smooth bore muskets had an effective range of less than By the end of the Civil War there were over 1 000 If Confederate soldiers captured Spencer Rifles they could not be used because A Gatling gun could fire Gatling guns were revolutionary because while other barrels fired The large bullets during the Civil War Unlike earlier muskets Spencer Rifles could be fired in less than Earthworks and fortification were essential during the Civil War because The benefit of the new Minie ball bullet was that The Ironclad CSS Virginia was outfitted with the telegraph 6 knots the telegraph 100 yards 200 rounds per minute
1 Describe the process of binary fission
Biology
The Living World
1 Describe the process of binary fission
Needed Safety ding JBA Data Science Skills Online Learning Coursera Class Central Science Communication Certifications Outside of GSU inituencing and Relationship Building Mentors Weaknesses Resources Skill Gap At GSU Resume Career Services Grad Strategic Thinking Clifton Strengths Professional INTJ A Current Experience Self Assessment Shark Researcher recommendation Write personal J statement Publish primary research Obtain Bachelors Degree Short Term Long Term Narrow down research focus Work towards PhD Present at STEM conference PhD in Marine Biology Find faculty in shark research Lab Safety programa Research Professional Organizations Coding Certifications SCUBA Join a Professional Organization
Biology
The Living World
Needed Safety ding JBA Data Science Skills Online Learning Coursera Class Central Science Communication Certifications Outside of GSU inituencing and Relationship Building Mentors Weaknesses Resources Skill Gap At GSU Resume Career Services Grad Strategic Thinking Clifton Strengths Professional INTJ A Current Experience Self Assessment Shark Researcher recommendation Write personal J statement Publish primary research Obtain Bachelors Degree Short Term Long Term Narrow down research focus Work towards PhD Present at STEM conference PhD in Marine Biology Find faculty in shark research Lab Safety programa Research Professional Organizations Coding Certifications SCUBA Join a Professional Organization
What is the significance of the quotation taken from the following passage taken from the essay Petrarch s Plague The year of 1348 left us alone and hopeless Petrarch declared at the very beginning of his Familiar Letters OIt shows the severity of the Plague O It shows that the year of 1348 was good O It shows the significant events of 1348 O It has no supporting information
Biology
The Living World
What is the significance of the quotation taken from the following passage taken from the essay Petrarch s Plague The year of 1348 left us alone and hopeless Petrarch declared at the very beginning of his Familiar Letters OIt shows the severity of the Plague O It shows that the year of 1348 was good O It shows the significant events of 1348 O It has no supporting information
Sort the electron acceptors that are able to diffuse inside the mitochondrial matrix from those that are immobilized in a protein complex in their active state Drag each item to the appropriate bin View Available Hint s flavin mononucleotide flavin adenine dinucleotide Able to diffuse into mitochondrial matrix nicotinamide adenine dinucleotide coenzyme Q iron sulfur clusters Unable to diffuse into mitochondrial matrix Reset Help cytochromes
Biology
Plant Physiology - Respiration
Sort the electron acceptors that are able to diffuse inside the mitochondrial matrix from those that are immobilized in a protein complex in their active state Drag each item to the appropriate bin View Available Hint s flavin mononucleotide flavin adenine dinucleotide Able to diffuse into mitochondrial matrix nicotinamide adenine dinucleotide coenzyme Q iron sulfur clusters Unable to diffuse into mitochondrial matrix Reset Help cytochromes
Effective communication is key to increasing awareness of your brand products and services Digital communication has become increasingly important Social media email newsletters websites digital publications Big emphasis on analytics measurement and data Speed flexibility and accuracy are important Fun and rewarding field At a university college institute we re promoting research projects and academic programs
Biology
Ecology - General
Effective communication is key to increasing awareness of your brand products and services Digital communication has become increasingly important Social media email newsletters websites digital publications Big emphasis on analytics measurement and data Speed flexibility and accuracy are important Fun and rewarding field At a university college institute we re promoting research projects and academic programs
Drag the appropriate items to their respective bins The first stage step 2 step 3 step 8 step 4 The second stage You sorted 2 out of 8 items incorrectly No credit lost Try again step 5 step 6 step 1 Reset Help step 7
Biology
Plant Physiology - General
Drag the appropriate items to their respective bins The first stage step 2 step 3 step 8 step 4 The second stage You sorted 2 out of 8 items incorrectly No credit lost Try again step 5 step 6 step 1 Reset Help step 7
Have balance To avoid a biased article research contradicting evidence and determine how if you will present the information Evaluate the credibility and quality of the science Contact experts Ask scientists about their findings and their field Reach out to other scientists to fact check information Don t overstate or overexaggerate findings Don t mislead with statistics When using percentages don t inflate the significance of the figure Write simply and clearly General readers aren t scientific experts so simplify scientific terminology and concepts
Biology
The Living World
Have balance To avoid a biased article research contradicting evidence and determine how if you will present the information Evaluate the credibility and quality of the science Contact experts Ask scientists about their findings and their field Reach out to other scientists to fact check information Don t overstate or overexaggerate findings Don t mislead with statistics When using percentages don t inflate the significance of the figure Write simply and clearly General readers aren t scientific experts so simplify scientific terminology and concepts
Hook reader from the beginning Organize your ideas with an outline Look for most newsworthy facts and interesting quotes Use inverted pyramid story structure Newswriting format that summarizes the most important facts at beginning of story Begin with the lead a sentence that summarizes the key informati of the story Add paragraphs in the order of relevance and importance Use words general readers can understand Explain scientific or technical terms if these words are needed Use transitions between paragraphs
Biology
The Living World
Hook reader from the beginning Organize your ideas with an outline Look for most newsworthy facts and interesting quotes Use inverted pyramid story structure Newswriting format that summarizes the most important facts at beginning of story Begin with the lead a sentence that summarizes the key informati of the story Add paragraphs in the order of relevance and importance Use words general readers can understand Explain scientific or technical terms if these words are needed Use transitions between paragraphs
HOOK the beginning Organize your ideas with an outline Look for most newsworthy facts and interesting quotes Use inverted pyramid story structure Newswriting format that summarizes the most important facts at beginning of story D Begin with the lead a sentence that summarizes the key information of the story Add paragraphs in the order of relevance and importance Use words general readers can understand Explain scientific or technical terms if these words are needed Use transitions between paragraphs phrases that keep the story flowing and let the reader kno
Biology
The Living World
HOOK the beginning Organize your ideas with an outline Look for most newsworthy facts and interesting quotes Use inverted pyramid story structure Newswriting format that summarizes the most important facts at beginning of story D Begin with the lead a sentence that summarizes the key information of the story Add paragraphs in the order of relevance and importance Use words general readers can understand Explain scientific or technical terms if these words are needed Use transitions between paragraphs phrases that keep the story flowing and let the reader kno
The inhibitors of the electron transport chain are substances that bind to some of the components and block the passage of electrons at different points in the chain This inhibition results in the accumulation of reduced forms before the inhibition point whe the inhibitor blocks the flow of electron and oxidized forms of the components of the electron transport chain behind the inhibition point Recall that reduction is gain of electrons whereas oxidation is loss of electrons When a component of the electron transport chain accepts an electron it gets reduced and when it transfers its electrons to an acceptor it gets oxidized and the acceptor becomes reduced For example in the following reaction coenzyme Q is in the oxidized form and accepts an electron to be in the reduced form If we were to add a drug that blocks electron transfer at this step coenzyme Q would remain oxidized and FADH would remai reduced Drag the appropriate labels to their respective targets View Available Hint s Identify the complexes and mobile electron carriers that remain reduced and oxidized due to the following blocker inhibitors You can use the electron transport chain labeled in part A to help answer this question Complex IIl Cytochrome c Complex 1 Coenzyme Q Complex IV Inhibitor Blocker FADH Reduced form Amytal is a painkiller that blocks the flow of electrons to Coenzyme Q Cyanide is a poison that blocks the flow of electrons to oxygen Complex IV Antimycin is an antibiotic that blocks the flow of electrons to Cytochrome c Rotenone is an insecticide that blocks the flow of CoQ FAD CoQH Oxidized form Oxidized form Reduced form Last component that can be Last component that remains reduced due to inhibitor blocker axidized due to inhibitor blocker Reset Help
Biology
The Living World
The inhibitors of the electron transport chain are substances that bind to some of the components and block the passage of electrons at different points in the chain This inhibition results in the accumulation of reduced forms before the inhibition point whe the inhibitor blocks the flow of electron and oxidized forms of the components of the electron transport chain behind the inhibition point Recall that reduction is gain of electrons whereas oxidation is loss of electrons When a component of the electron transport chain accepts an electron it gets reduced and when it transfers its electrons to an acceptor it gets oxidized and the acceptor becomes reduced For example in the following reaction coenzyme Q is in the oxidized form and accepts an electron to be in the reduced form If we were to add a drug that blocks electron transfer at this step coenzyme Q would remain oxidized and FADH would remai reduced Drag the appropriate labels to their respective targets View Available Hint s Identify the complexes and mobile electron carriers that remain reduced and oxidized due to the following blocker inhibitors You can use the electron transport chain labeled in part A to help answer this question Complex IIl Cytochrome c Complex 1 Coenzyme Q Complex IV Inhibitor Blocker FADH Reduced form Amytal is a painkiller that blocks the flow of electrons to Coenzyme Q Cyanide is a poison that blocks the flow of electrons to oxygen Complex IV Antimycin is an antibiotic that blocks the flow of electrons to Cytochrome c Rotenone is an insecticide that blocks the flow of CoQ FAD CoQH Oxidized form Oxidized form Reduced form Last component that can be Last component that remains reduced due to inhibitor blocker axidized due to inhibitor blocker Reset Help
Select the electron carriers involved in the electron transport chain Check all that apply View Available Hint s flavin mononucleotide cytochrome C glyceraldehyde 3 phosphate glucose iron sulfur clusters phosphate
Biology
The Living World
Select the electron carriers involved in the electron transport chain Check all that apply View Available Hint s flavin mononucleotide cytochrome C glyceraldehyde 3 phosphate glucose iron sulfur clusters phosphate
In the diagram below the red arrows show the flow of energy through the electron transport chain Follow the flow of electrons through the electron transport chain and label the components of the chain Drag the appropriate labels to their respective targets View Available Hint s ATP synthase Coenzyme Q Complex III Complex II Complex IV Cytochrome c Complex I Intermembrane Space Inner Mitochondrial Membrane Mitochondrial Matrix 2H 2H 2H NADH H NAD FADH FAD 2H H O HT Channel 999999 Reset Help
Biology
Human Physiology - Chemical Coordination
In the diagram below the red arrows show the flow of energy through the electron transport chain Follow the flow of electrons through the electron transport chain and label the components of the chain Drag the appropriate labels to their respective targets View Available Hint s ATP synthase Coenzyme Q Complex III Complex II Complex IV Cytochrome c Complex I Intermembrane Space Inner Mitochondrial Membrane Mitochondrial Matrix 2H 2H 2H NADH H NAD FADH FAD 2H H O HT Channel 999999 Reset Help
Label the steps of electron transport leading to oxidative phosphorylation where ATP is synthesized from ADP using the energy stored by the electron transport chain Drag the appropriate labels to their respective targets View Available Hint s Proton flow is accompanied by electron transfer into the intermembrane space Protons return to the matrix through a proton specific channel Protons release potential energy which drives the phosphorylation of ADP to ATP Electron flow is accompanied by proton transfer into the intermembrane space Electron transfer into the matrix releases potential energy which drives phosphorylation of ADP Electrons from oxidizable substrates pass through the electron transport chain A proton concentration gradient is established Reset Help
Biology
The Living World
Label the steps of electron transport leading to oxidative phosphorylation where ATP is synthesized from ADP using the energy stored by the electron transport chain Drag the appropriate labels to their respective targets View Available Hint s Proton flow is accompanied by electron transfer into the intermembrane space Protons return to the matrix through a proton specific channel Protons release potential energy which drives the phosphorylation of ADP to ATP Electron flow is accompanied by proton transfer into the intermembrane space Electron transfer into the matrix releases potential energy which drives phosphorylation of ADP Electrons from oxidizable substrates pass through the electron transport chain A proton concentration gradient is established Reset Help
stion 1 Match the term person with the appropriate description True breeding v Alleles Phenotype Testcross Pleiotropy Polygenic inheritance Incomplete dominance Codominance A When an individual with unknown genotype is crossed with the homozygous recessive genotype B More than one gene can affect a single trait C The physical appearance or other observable characteristics of an individual which result from allele expression D The phenotype of the heterozygote is intermediate between the two homozygotes E The offspring produced from self fertilization remain uniform from one generation to the next F The heterozygote shows some aspect of the phenotype of both homozygotes G A single gene can affect more than one trait H Different forms of the same gene
Biology
Morphology of Flowering Plants
stion 1 Match the term person with the appropriate description True breeding v Alleles Phenotype Testcross Pleiotropy Polygenic inheritance Incomplete dominance Codominance A When an individual with unknown genotype is crossed with the homozygous recessive genotype B More than one gene can affect a single trait C The physical appearance or other observable characteristics of an individual which result from allele expression D The phenotype of the heterozygote is intermediate between the two homozygotes E The offspring produced from self fertilization remain uniform from one generation to the next F The heterozygote shows some aspect of the phenotype of both homozygotes G A single gene can affect more than one trait H Different forms of the same gene
v 1 V 2 V 3 4 V 5 6 7 8 V 9 Heredity Genes for a trait Segregation of alleles 2 Physical form 6 1 copy of each gene Heredity 2 copies of each gene 8 A Phenotype B Genotype C Diploid D Mendel s first law E Dominant F Allele G Homozygous H Recessive 1 Haploid J Heterozygous Same Expressed in heterozygote Form of a gene 3 4 Expression Different Hidden in 10 heterozygote
Biology
The Living World
v 1 V 2 V 3 4 V 5 6 7 8 V 9 Heredity Genes for a trait Segregation of alleles 2 Physical form 6 1 copy of each gene Heredity 2 copies of each gene 8 A Phenotype B Genotype C Diploid D Mendel s first law E Dominant F Allele G Homozygous H Recessive 1 Haploid J Heterozygous Same Expressed in heterozygote Form of a gene 3 4 Expression Different Hidden in 10 heterozygote
How do symbiotic bacteria play a role in keeping us healthy Select 3 correct answer s product cells that attack foreign invaders produce proteins to help us build and repair tissue make our skin more acidic to reduce growth of other micro organisms hijack our cells to reproduce themselves make our skin more basic so it is hospitable to other bacteria produce enzymes that help us digest food 00000
Biology
Human Physiology - Digestion
How do symbiotic bacteria play a role in keeping us healthy Select 3 correct answer s product cells that attack foreign invaders produce proteins to help us build and repair tissue make our skin more acidic to reduce growth of other micro organisms hijack our cells to reproduce themselves make our skin more basic so it is hospitable to other bacteria produce enzymes that help us digest food 00000
Base your answer to this question on the proclamation below and on your knowledge of social studies Article 1 General Toussaint and General Christophe are outlawed every good citizen is commanded to seize them and to treat them as rebels to the French Republic Leclerc Saint Domingue proclamation 1802 Based on this 1802 French proclamation the French government reacted to the Haitian Revolution by 1 2 3 4 accepting Haitian demands to end slavery and oppression encouraging Haitians to rebel against French rule ordering the capture of Haitian revolutionary leaders agreeing to give Haitians all the rights
Biology
Ecology - General
Base your answer to this question on the proclamation below and on your knowledge of social studies Article 1 General Toussaint and General Christophe are outlawed every good citizen is commanded to seize them and to treat them as rebels to the French Republic Leclerc Saint Domingue proclamation 1802 Based on this 1802 French proclamation the French government reacted to the Haitian Revolution by 1 2 3 4 accepting Haitian demands to end slavery and oppression encouraging Haitians to rebel against French rule ordering the capture of Haitian revolutionary leaders agreeing to give Haitians all the rights
Can you please send me a primary research article about protein synthesis involved in creating the traits of a human being
Biology
Principles of Inheritance & Variation (Genetics)
Can you please send me a primary research article about protein synthesis involved in creating the traits of a human being
Can you please send me a primary research article about protein synthesis involved in creating the traits of a human being
Biology
The Living World
Can you please send me a primary research article about protein synthesis involved in creating the traits of a human being
Synaptonemal E complex Centromere Homologues Sister chromatids Kinetochore 12 E Image Description
Biology
Cell Cycle and Cell Division
Synaptonemal E complex Centromere Homologues Sister chromatids Kinetochore 12 E Image Description
Products of meiosis I in a frog A geneticist examines the karyotype of a diploid cell from a particular species of frog and determines that 12 chromosomes are present If a germ line cell from this species divides by meiosis then at the end of meiosis I each cell will have Check all that apply Check All That Apply 12 centromeres 12 chromatids 6 chromosomes
Biology
Cell Cycle and Cell Division
Products of meiosis I in a frog A geneticist examines the karyotype of a diploid cell from a particular species of frog and determines that 12 chromosomes are present If a germ line cell from this species divides by meiosis then at the end of meiosis I each cell will have Check all that apply Check All That Apply 12 centromeres 12 chromatids 6 chromosomes
Chromosome number and structure during G2 In a human somatic cell normal body cell that is in G2 what would be true about chromosome number and structure Check all that apply Check All That Apply These cells would be considered haploid n The chromosomes would be in the replicated state The chromosomes would be attached to microtubules at their centromeres These cells would contain homologous chromosomes
Biology
Biotechnology & its Applications
Chromosome number and structure during G2 In a human somatic cell normal body cell that is in G2 what would be true about chromosome number and structure Check all that apply Check All That Apply These cells would be considered haploid n The chromosomes would be in the replicated state The chromosomes would be attached to microtubules at their centromeres These cells would contain homologous chromosomes
86 For theorists Karl Marx and Friedrich Engels the most important class distinction in capitalist societies was between the proletariat and the bourgeoisie the capitalists and the bourgeoisie the proletariat and the serfs the serfs and the bourgeoisie a b C d
Biology
Biological Classification
86 For theorists Karl Marx and Friedrich Engels the most important class distinction in capitalist societies was between the proletariat and the bourgeoisie the capitalists and the bourgeoisie the proletariat and the serfs the serfs and the bourgeoisie a b C d
77 Polygamists believe that monogamy is not a natural state for human beings They feel that people should have multiple spouses at the same time rather than just one spouse Although polygamy is illegal in the United States there are many people around the world who engage in this practice including some who do so in the United States despite the legal restrictions Polygamists who live in the United States are an example of a subculture mainstream culture popular culture a b C counterculture
Biology
Biotechnology & its Applications
77 Polygamists believe that monogamy is not a natural state for human beings They feel that people should have multiple spouses at the same time rather than just one spouse Although polygamy is illegal in the United States there are many people around the world who engage in this practice including some who do so in the United States despite the legal restrictions Polygamists who live in the United States are an example of a subculture mainstream culture popular culture a b C counterculture
es materials from the cell nto the cell the picture below with the following words hydrophobic hydrophilic water phosp bilayer DOOOOOO PROPAS CA SUCCUL out
Biology
Morphology of Flowering Plants
es materials from the cell nto the cell the picture below with the following words hydrophobic hydrophilic water phosp bilayer DOOOOOO PROPAS CA SUCCUL out
28 Fill in the blanks within the diagram of respiration belo are Krebs cycle fermentation mitochondria cell membrane cytoplasm glucose and pyruvic acid 0 anaerobic without oxygen M
Biology
Human Physiology - Excretory Products & Elimination
28 Fill in the blanks within the diagram of respiration belo are Krebs cycle fermentation mitochondria cell membrane cytoplasm glucose and pyruvic acid 0 anaerobic without oxygen M
Examine the labelled cross section of a worm Identify which worm that we examined during the Animals I materials this cross section belongs to longitudinal muscle typhlosole lumen of intestine circular muscle subneural blood vessel Answer dorsal blood vessel epidermis coelom ventral blood vessel ventral nerve cord
Biology
Animal Kingdom
Examine the labelled cross section of a worm Identify which worm that we examined during the Animals I materials this cross section belongs to longitudinal muscle typhlosole lumen of intestine circular muscle subneural blood vessel Answer dorsal blood vessel epidermis coelom ventral blood vessel ventral nerve cord
You are examining this specimen under the 4x objective lens Identify the Phylum Time left 0 16 40
Biology
Human Physiology - Circulatory System
You are examining this specimen under the 4x objective lens Identify the Phylum Time left 0 16 40
we the provided specimen seen under 4x Identify the pattern of symmetry group
Biology
Animal Kingdom
we the provided specimen seen under 4x Identify the pattern of symmetry group
e ragworm provided here Identify the coelom status of this organism is e pseudocoelomate or coelomate
Biology
The Living World
e ragworm provided here Identify the coelom status of this organism is e pseudocoelomate or coelomate
Original DNA Strand TTACAAJAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 6 Red blood cells have a protein called hemoglobin that carries oxygen A mutation to the hemoglobin gene causes the disease sickle cell anemia Below is the portion of the hemoglobin gene where the mutation is found For each strand of DNA write the mRNA sequence circle the mRNA codons and write the amino acid sequence Normal hemoglobin DNA T ACCACCTGGACTGAGGACTCCTC mRNA Strand Amino Acid Sequence Mutated hemoglobin DNA resulting in sickle cell TACCACC TGGACTGAGGACAC CTC mRNA Strand Amino Acid Sequence What is the difference between the normal hemoglobin protein and the sickle cell hemoglobin protein What specific kind of mutation causes sickle cell anemia
Biology
The Living World
Original DNA Strand TTACAAJAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 6 Red blood cells have a protein called hemoglobin that carries oxygen A mutation to the hemoglobin gene causes the disease sickle cell anemia Below is the portion of the hemoglobin gene where the mutation is found For each strand of DNA write the mRNA sequence circle the mRNA codons and write the amino acid sequence Normal hemoglobin DNA T ACCACCTGGACTGAGGACTCCTC mRNA Strand Amino Acid Sequence Mutated hemoglobin DNA resulting in sickle cell TACCACC TGGACTGAGGACAC CTC mRNA Strand Amino Acid Sequence What is the difference between the normal hemoglobin protein and the sickle cell hemoglobin protein What specific kind of mutation causes sickle cell anemia
1 Define aggregate demand and identify its four sources
Biology
Human Physiology - Excretory Products & Elimination
1 Define aggregate demand and identify its four sources
You will use this original strand of DNA to complete numbers 1 5 1 Write the mRNA sequence that would be made from the original strand of DNA circle the mRNA codons and write the amino acid sequence Original DNA Strand ITACAATAGACGGIAAACT mRNA Strand Amino Acid Sequence 2 Change the 7th nucleotide in the original DNA strand from a T to a C Original DNA Strand ITACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 3 Add a G to the original DNA strand after the 4th nucleotide not replacing anything Original DNA Strand TTACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 4 Change the 6th nucleotide in the original DNA strand from an A to a T Original DNA Strand TTACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand
Biology
Biotechnology & its Applications
You will use this original strand of DNA to complete numbers 1 5 1 Write the mRNA sequence that would be made from the original strand of DNA circle the mRNA codons and write the amino acid sequence Original DNA Strand ITACAATAGACGGIAAACT mRNA Strand Amino Acid Sequence 2 Change the 7th nucleotide in the original DNA strand from a T to a C Original DNA Strand ITACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 3 Add a G to the original DNA strand after the 4th nucleotide not replacing anything Original DNA Strand TTACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 4 Change the 6th nucleotide in the original DNA strand from an A to a T Original DNA Strand TTACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand