Biology Questions

es materials from the cell nto the cell the picture below with the following words hydrophobic hydrophilic water phosp bilayer DOOOOOO PROPAS CA SUCCUL out

28 Fill in the blanks within the diagram of respiration belo are Krebs cycle fermentation mitochondria cell membrane cytoplasm glucose and pyruvic acid 0 anaerobic without oxygen M

Examine the labelled cross section of a worm Identify which worm that we examined during the Animals I materials this cross section belongs to longitudinal muscle typhlosole lumen of intestine circular muscle subneural blood vessel Answer dorsal blood vessel epidermis coelom ventral blood vessel ventral nerve cord

You are examining this specimen under the 4x objective lens Identify the Phylum Time left 0 16 40

we the provided specimen seen under 4x Identify the pattern of symmetry group

e ragworm provided here Identify the coelom status of this organism is e pseudocoelomate or coelomate

Original DNA Strand TTACAAJAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 6 Red blood cells have a protein called hemoglobin that carries oxygen A mutation to the hemoglobin gene causes the disease sickle cell anemia Below is the portion of the hemoglobin gene where the mutation is found For each strand of DNA write the mRNA sequence circle the mRNA codons and write the amino acid sequence Normal hemoglobin DNA T ACCACCTGGACTGAGGACTCCTC mRNA Strand Amino Acid Sequence Mutated hemoglobin DNA resulting in sickle cell TACCACC TGGACTGAGGACAC CTC mRNA Strand Amino Acid Sequence What is the difference between the normal hemoglobin protein and the sickle cell hemoglobin protein What specific kind of mutation causes sickle cell anemia

1 Define aggregate demand and identify its four sources

You will use this original strand of DNA to complete numbers 1 5 1 Write the mRNA sequence that would be made from the original strand of DNA circle the mRNA codons and write the amino acid sequence Original DNA Strand ITACAATAGACGGIAAACT mRNA Strand Amino Acid Sequence 2 Change the 7th nucleotide in the original DNA strand from a T to a C Original DNA Strand ITACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 3 Add a G to the original DNA strand after the 4th nucleotide not replacing anything Original DNA Strand TTACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 4 Change the 6th nucleotide in the original DNA strand from an A to a T Original DNA Strand TTACAATAGACGGTAAACT Mutated DNA Strand mRNA Strand

2 Discuss why the aggregate demand curve slopes downward

slopes downward 2 Discuss why the aggregate demand curve

1 Define aggregate demand and identify its four sources

What will be the total number of molecules of NADH FADH2 and GTP that are synthesized if the citric acid cycle repeats 18 times Express your answers as integers separated by commas View Available Hint s AEO Number of NADH FADH GTP molecules 54 18 36

Mitosis 1 List the phases of the cell cycle and describe the sequence of events that occurs during each phase 2 List the phases of mitosis and describe the events characteristic of each phase 3 Recognize the phases of mitosis from diagrams and micrographs 4 Compare cytokinesis in animals and plants Meiosis 1 List the phases of meiosis I and meiosis II and describe the events characteristic of each phase Recognize the phases of meiosis from diagrams or micrographs 2 Describe the process of synapsis during prophase I and explain how genetic recombination occurs 3 Describe the key differences between mitosis and meiosis Explain how the end result of meiosis differs from that of mitosis

Photosynthesis 1 Distinguish between autotrophic and heterotrophic nutrition 2 Distinguish between photoautotrophs and chemoautotrophs 3 Describe the structure of chloroplasts 4 Write a summary equation for photosynthesis 5 Explain the role of redox reactions in photosynthesis 6 Describe in general the two main stages of photosynthesis 7 Explain what happens when chlorophyll or accessory pigments absorb photons 8 List the components of a photosystem and explain their functions 9 Trace electron flow through photosystems II and I 10 Compare and contrast chemiosmosis in mitochondria which results in oxidative phosphorylation and photophosphorylation in chloroplasts 11 Describe the role of ATP and NADPH in the Calvin cycle 12 Summarize the Calvin cycle What goes in What comes out

Instructions Using the case study below write a concise APA paper using bullet points Include an APA style Title page 3 8 Concise and PRECISE BULLET POINTS FOR EACH SECTION At least one in text citation an APA style Reference page You may use your textbook and other current textbooks Include one PEER REVIEWED reference De not that ends withog com edu or gov se the following four Level 1 headings within your paper Pathophysiology of the Disorder Etiology of the Disorder A B is experiencing Clinical manifestations of the Disorder A B is experiencing Expected Treatment Options for A B Based on the pathophysiology of the disorder and clinical manifestations on peer reviewed references Nothing A 21 year old female A B presents to the urgent care clinic with symptoms of nausea vomiting diarrhea and a fever for 3 days She states that she has Type I diabetes and has not been managing her blood sugars since she s been ill She is unable to keep anything down She only tolerates sips of water and juices Since she s been unable to eat she hasn t taken any long or rapid acting insulin as directed While helping A B from the lobby to the examining room you note that she s unsteady on her feet her skin is warm and flushed and she s drowsy You also note that she s breathing rapidly and her breath has a sweet fruity odor A B has a challenge answering questions but keeps asking for water to drink You get more information from A B and learn the following She had some readings on her glucometer which were reading high She vomits almost every time she takes in fluid She hasn t voided for a day but she voided a great deal yesterday She s been sleeping long hours and finally woke up this morning and decided to seek care Current labs and vital signs BP 88 46 HR 132 BPM RR 28 min deep Temperature 101 3 F

itehsh Interphase The cell can grew then this means they will grow its DNA B Whitefish Late Prophase Using 40x Objective Lens The spindles begin to capture making them able to organize the chromosomes C Whitefish Metaphase Using 40x Objective Lens The chromosomes will start to condense each and then after that get coiled D Whitefish Late Anaphase Using 40x Objective Lens

subunits transcription process catalyzes the association between the large and small ribosomal an enzyme that uses RNA as a substrate an RNA with enzymatic activity Question 40 1 point Listen Saved The 5 end of a DNA molecule can be chemically distinguished from the 3 end because there is a n group at the 5 end and a n group at the 3 end hydroxyl hydrogen amine carboxyl

Tandemly repeated DNA Introns Interspersed repeated DNA Question 38 1 point Listen Saved The base composition in DNA isolated from cow liver cells is 28 adenine what percent of the bases are cytosine 22 36 28

prokaryotes eukaryotes humans Question 30 1 point Listen Which of the following molecule s help s to hold the DNA strands apart while they are being replicated Saved single strand binding proteins DNA polyermase primase

conservative dispersive irregular Question 28 1 point Saved 1 Listen Which of the following is involved in proofreading during DNA replicat ORNA polymerase endonuclease activity of DNA polymerase exonuclease activity of DNA polymerase

binds before the elongation factor tRNA small ribosomal subunit large ribosomal subunit large ribosomal subunit small ribosomal subunit elongation factor mRNA Question 2 1 point Listen Which of the following structures contains the receptor protein importin Nucleolus Nucleus Saved O Chloroplast

Numerous Xenopus cells were exposed to varying amounts of ultraviolet light Som of the resulting cells were observed to lack nucleoli As a result one would expect that the cell could not synthesize ribosomal RNA Operform cellular respiration perform photosynthesis replicate its DNA

osome the type of mutation is referred to as a duplication an inversion a translocation a nonsense mutation Question 10 1 point Saved Listen Strand slippage results in such as fragile X syndrome which can cause a number of human diseases pyrimidine dimer addition the re replication of highly repetitive DNA sequences EDNA

The nontemplate strand reads 5 ACTGGTTCA What will be the sequence of the resulting transcript for this portion 5 UUGCAAUGA 5 ACUGGUUCA 5 UGACCANGUL

Release factors of translation recognize the codon OUGA UUU OGUA

Sister chromatids are joined by centrosomes Onucleosomes O centrioles centromeres

What is the function of topoisomerase adding methyl groups to bases of DNA relieving strain in coils in the DNA ahead of the replication fork unwinding of the double helix elongating new DNA at a replication fork by adding nucleotides to the existing chain

Which of the following statements correctly describes alternative RNA splicing It is a mechanism that can increase the rate of transcription It can allow the production of different protein products from a single mRNA It allows the production of similar proteins from different RNAs It increases the rate of transcription

DNA polyermase I plays an important role in transcription Orecombination Otranslation excision repair

RNA elongation proceeds in O 5 to 3 direction 3 to 5 along the template strand

Which of the following types of mutation resulting in an error in the mRNA just after the 5 AUG start codon is likely to have the most serious effect on the polypeptide product a substitution of the second nucleotide of a GGG codon a substitution of the third nucleotide in an ACC codon a substitution of the first nucleotide of a GGG codon a deletion of two nucleotides

ribozyme an enzyme that synthesizes RNA as part of the transcription process an enzyme that catalyzes the association between the large and small ribosoma subunits an enzyme that uses RNA as a substrate an RNA with enzymatic activity

Which type of DNA makes up the largest portion of the human genome Exons Tandemly repeated DNA Introns

The codon for phenylalanine is UUU Which of the following codons also most likely encodes for phenylalanine AAA UUC CUU

Why do histones bind tightly to DNA Histones are negatively charged and DNA is positively charged Both histones and DNA are strongly hydrophobic Histones are covalently linked to the DNA Histones are positively charged and DNA is negatively charged

Which of the following molecule s help s to hold the DNA strands apart while they are being replicated single strand binding proteins DNA polyermase primase

Small particles can pass through the nucleus through aqueous diffusion channels O active transpot Ran pathway proton pumps

Which of the following experimental procedures is most likely to speed up mRNA degradation in a eukaryotic cell Olengthening of the poly A tail removal of one or more exons removal of the 5 cap removal of C nucleotides

Which of the following is not a true statement regarding the genetic code The genetic code is nonoverlapping The genetic code is degenerate The genetic code is nearly universal with only a few minor exceptions Each codon represents a different amino acid

Each of the following are associated with replicons except Ominichromosome maintenance proteins origin of replication TATA box helicase

Ran GTP gradient is maintained by Onucleoskeleton GEF outside the nucleus O GAP inside the nucleus O GEF inside the nucleus

DNA replication is Osemiconservative O conservative Odispersive irregular

Introns are sequences that O code for proteins are methylated on the pre rRNA spliced out of the pre mRNA terminate RNA transcription

The energy needed to polymerize DNA is supplied by the hydrolysis of the phosphate bonds of the deoxynucleoside triphosphates that are being added to the new DNA chain the hydrolysis of the RNA primers used in DNA replication the hydrolysis of the phosphate bonds of ATP the hydrolysis of the phosphate bonds of ATP or GTP

What is the role of DNA ligase in the elongation of the lagging strand during DNA replication It synthesizes RNA nucleotides to make a primer It catalyzes the lengthening of telomeres It joins Okazaki fragments together It unwinds the parental double helix

1 In which order do the necessary enzymes act to repair a thymine dimer by nucleotide excision repair DNA ligase nuclease helicase nuclease DNA polymerase DNA ligase nuclease DNA polymerase RNA primase helicase DNA polymerase DNA ligase

The transcription preinitation complex includes transcription factors and RNA polyermase on the promoter can be formed in the absence of a core promoter elongation can proceed without the preinitiation complex assembling first O includes the poly A tail and RNA polyermase on the promoter

Multiple sites of DNA replication along eukaryotic chromosomes are known as O promotors ARS elements replicons

Which of the following statements correctly compares transcription in prokaryotes and eukaryotes Both eukaryotes and prokaryotes recognize a polyadenylation signal in order to terminate transcription Prokaryotes have one type of RNA polymerase whereas eukaryotes have at least three Transcription factors are only required in prokaryotes Promotors of prokaryotes are more complex than euakryotic promotors