Biology Questions

O is released by the action of the thyroid O regulates blood pressure O has a sequence identical to oxytocin O is a physiologically active dipeptide is a hormone that causes the smooth muscles of the mammary glands to ce

3 Choose the true statement s about fermentation select all that apply a If a fermentation reaction occurs the phenol red media should turn yellow b All fermentation reactions produce gas as a byproduct c Fermentation reactions do not require oxygen d Glycolysis is the first stage of fermentation e Fermentation can only occur under anaerobic conditions

6 Assume you conduct a phenol red glucose test on an unknown bacterium and after incubation you obtain an A result What can you reasonably conclude about the bacterium Select all that apply a The bacterium ferments the sugar glucose b The bacterium makes alkaline metabolic byproducts c The bacterium made acidic end products d The bacterium does not make gas as a fermentation byproduct e There was an absence of gas as well as an absence of a color change

1 Choose the false statement s about the phenol red test select all that apply a It can detect if an organism ferments a specific sugar b It is a differential medium c It is a selective medium d It is inoculated with a mixed culture e It may contain multiple sugars in the same sample tube

5 The enzyme Occur is required to split sucrose into monosaccharides before fermentation

4 Mark each statement as true or false and correct the false statements so they read as true Monosaccharides must be converted to disaccharides before being metabolized by fermentation pathways Before it can be fermented lactose must be split into simple sugars by the enzyme glucosidase Sucrose is a disaccharide made up of fructose and glucose A bacterium may conduct oxidative phosphorylation as well as fermentation

2 Suppose you perform this exercise and upon making your observation you notice the media outside the Durham tube is red while the media inside the Durham tube is yellow What conclusions could you make Be sure to explain your reasoning

2 The purpose of the Durham tube in the media is a To stabilize the media s pH b To capture gas made as a fermentation byproduct c To remove oxygen from the media d To help oxygen diffuse through the media e To detect the media s pH

Critical Thinking 1 Should you anticipate a bubble in the Durham tube if the media is red Explain your reasoning

Critical Thinking 1 Why is it necessary to use two controls uninoculated control and a nonsaccharolytic sample rather than just one What are the specific purposes of each Be thorough in your answer

6 In the O F test performed in this exercise served as a protein source served as the carbohydrate source whi

The O F test is selective for bacteria that conduct fermentation versus aerobic oxidative respiration 4 Facultative anaerobes such as members of the family Enterobacteriaceae are capable of both aerobic respiration and fermentation What color results would you expect for such organisms when grown in O F glucose media a The sealed media should turn yellow and the unsealed media should remain green b The sealed media should remain green and the unsealed media should turn yellow c The sealed tube should turn yellow and the unsealed tube should turn blue d Both the sealed and unsealed media should turn yellow e Both the sealed and unsealed tubes should remain green

3 Mark each statement as true or false and correct the false statements so they read as true If a bacterium carries out oxidative metabolism it cannot also carry out fermentation O F media is designed to detect the alkaline byproducts of fermentation O F media provides a single carbohydrate source The O F test is selective for bacteria that conduct fermentation versus aerobic oxidative respiration 57

2 Why is mineral oil added in the O F test a To serve as a nutrient source b To keep potential pathogens from becoming airborne c To remove oxygen from the media d To help oxygen diffuse through the media e To maintain an anaerobic environment

1 Select the true statement s about O F media select all that apply a It is a differential medium b It is a selective medium c It contains methylene blue as a pH indicator d The test is inoculated in pairs so that the media can be sealed off from atmospheric oxygen in one case but not the e The media can differentiate between bacteria that use both oxidative and fermentation processes from those that o conduct fermentation

4 Students will write their genetic crosses and plans to generate a double mutant fly

The amino acid shown below is which of the following COO HN C H H C CH CH O tryptophan O proline O histidine O leucine arginine

For this pre lab assignment you will submit a 1 page drawing that demonstrates the differences between Mendel s two main laws the law of segregation and the law of independent assortment in a 2N 4 cell on your drawing include a hypothetical gene A on one pair of chromosomes a dominant A allele on one chromosome and the recessive a allele on its homologous partner and a hypothetical gene B on the second pair of chromosomes a dominant B allele on one chromosome and the recessive b allele on its homologous partner Include a written description of the main differences between the two laws and explain how each law impacts the movement of the gene A and gene B alleles into gametes You can using a drawing program or you can hand draw

1 Students will write a short summary about how early body plan is established in Drosophila embryos minimum 300 words

What did genetic analysis of the two groups of North Atlantic killer whales show A B C D Based on genetics they remain the same species The two groups have already diverged into separate species Genetic analysis revealed that the two groups are converging into one species The analysis showed variations that indicate they are diverging

Select all that apply The activities within a cell are similar to the transportation system of a city because Ocell organelle movement becomes clogged at times much like rush hour traffic slows specialized reactions are confined to certain areas of a cell just as specialized transportation systems like subways travel only along certain p the routes traveled by vehicles can be compared to reaction pathways in a cell transportation routes in a city operate simultaneously as do cell activities all molecules move from point A to point B like cars going down a one way street

Rank the sequence of cross bridge cycling starting with the myosin binding sites being exposed and ending with relaxation due to cross bridge cycling ending Do not overlap any events View Available Hint s Calcium ion concentration decreases below the threshold for binding to troponin First event Calcium ions pumped into the sarcoplasmic reticulum Power stroke moves thin filament Cross bridges detach from actin Myosin head forms cross bridge with actin Myosin binding sites covered Myosin head is re energized Reset Help ATP attaches to myosin head Last event

31 Which of the following is a inverse PCR method A using primers with 1 bp change to generate mutations no B using primers with restriction enzyme sequences adapter on the 5 end using primers that sequence outwards to obtain upstream and downstream sequence none of the above D

7 You have designed primers for PCR Which of the following is incorrect A You should have poly AAAAAA at 3 end B The annealing temperature of both primers should be similar C High GC content D the annealing temperature is about 5 degree below Tm allo

5 Pyrophosphate is a A building block for DNA synthesis B by product of DNA synthesis C precursor to DNA synthesis D fire phosphate used in nucleic acid metabolism All of the above E

The diagram below shows how DNA is sequenced Step 1 5 Step 2 ddCTP ddGTP ddTTP ddATP A T Step 3 STARSA Template strand 5 CGCA 3 Primer 3 GCGT 5 sequence known 5 T CGCA 3 3 AATGTGGGCTATICGGGCGT 5 5 TT CGCA 3 3 ATCTGGGCTATTCGGGCGT 5 Step 5 Step 6 3 Laser Step 4 Electrophoresis 3 A Longest A fragment PATCTGGGCTATICGG Detector G Shortest G fragment 5 3 AATCT GGGCT ATT CGG 5 Step 7 5 TTAGACCCGATAAGCCCGCA 3 babresa sortearE Soitin

Semiconservative replication of DNA involves A each of the original strands acting as a template for a new strand a B only one of the original strands acting as a template for a new strand C the complete separation of the original strands the synthesis of new strands an reassembly of double stranded molecules D the use of the original double stranded molecule as a template E None of the above The enzyme that unwinds the DNA prior to replication is called A DNA polymerase III D primase B DNA ligase E helicase C single stranded DNA binding protein DNA ligase A Keeps the two complementary strands of DNA separated B Untwists strands of DNA CD Links the 3 OH to the 5 PO4 forming the phosphodiester bridge D Processively adds a complementary nucleotide to the 3 end of a new strand o E Synthesizes short RNA primers 3 DNAiguae Por Lopping DNA gyrase 0 35 leading A Keeps the two complementary strands of DNA separated B Untwists strands of DNA C Links the 3 OH to the 5 PO4 forming the phosphodiester bridge D Processively adds a complementary nucleotide to the 3 end of a new strand

3 The florescent dye attached to ddNTPs in DNA sequencing A aids in visualization of the DNA strand when the ddNTP is incorporated and determine what base it is B acts as a catalyst for the reaction terminates the reaction aids in electrophoresis None of the above

4 Semiconservative replication of DNA involves B each of the original strands acting as a template for a new strand us of 20 only one of the original strands acting as a template for a new strand the complete separation of the original strands the synthesis of new strands reassembly of double stranded molecules the use of the original double stranded molecule as a template None of the above D E STOR

A B 1 In what way does a ddNTP differ from its dNTP counterparts The ddNTP has an extra COOH group The ddNTP has an extra OH group The ddNTP is missing an OH group D The ddNTP is a doublet of the dNTP E The ddNTP is not attached to the base C

Chemical synthesis of DNA Linking first nucleotide to column Removing oligonucleotide from column Purifying oligonucleotide Washing Detritylation Washing Activation and coupling 100 Washing Capping Oxidation n cycles What are the special nucleotide that used in this synthesis How is it different from regular nucleotide The direction of chemical synthesis What are on the platform column What would be the first nucleotide that linked to the platform column 5 GGATCGGAAT 3 How many bases are on the oligonucleotides after n cycles What technique is used to purify oligonucleotides Explain the following steps Detritylation Activation and Coupling Capping and Oxidation including washing after

PREDICTION 0 Atmosphere no 02 more CO2 Earliest 2 1 F Atmosphere more 02 less COZI ON B Haceral Cell Prokaryote Multicellutar Plant Energy Competition Chemoautotrophie Anaerobic Bacteria 3 Multicellular Animal Ocean of Molecules 12 AHME RNA 4 A 5 H C Cyanobacteria M sen 6 7 D GD H 1 Organic molecules N Prediction Provide a justification for your group s sequence of events HISTORY OF LIFE ON EARTH 8 H L E Unicellular Eukaryote 9 J Big Bang How did you know which cards to place first S the beginning BID bang What is the reason you placed the cards on the latest end Bis the latest beca 10 I 11 up you will first make a prediction about the sequence of events by placing the environment and organism cards along the timeline poster provided by the teacher Place earlier events on the left hand side of the timeline and later events on the right hand side Provide a justification for your choices in the space below 3 12 13 JE of the anivers e 14 Latest 15 F 3 Animal is Latest new to the world ar Which cards are you most uncertain about their placement everything comes First then s What questions do you now have

1 Calculate the population growth expected in a sample of E coli of 108 per ml in 10 ml of medium over 24 hours Hint use the Nert equation for population growth N Noe Where r 0 25 and 7 generations are expected over 24 hours

Name Serenity m Period 3 Directions For each of the following statements write true or false T or F 1 Carbon atoms can bond together in straight chains branched chains or rings 2 Large carbon based molecules composed of repeating subunits are commonly referred to as macromolecules E F 3 Polymers are formed by hydrolysis 4 Cells use carbohydrates for energy Directions Write each item below under the correct heading cellulose Sucrose Starch Monosaccharides 5 C6H12O6 6 Glucose 7 Pructose fructose glucose Disaccharide 8 lactose cellulare 9 Description 13 Form the structure that stores genetic information 14 Most consist of three fatty acids bonded to a glycerol molecule 15 DNA and RNA C6H O6 16 Commonly called fats and oils 17 Made up of amino acids 18 Used for long term energy storage insulation Lipids ON A Date 0 7 07 glycogen lactose 10 11 Polysaccharide starch 914209e 12Sucrose Proteins Nucleic Acids IDNA

Plants name Main plant Marigold Tagetes Other plants also included in lab Vinca Catharanthus roseus Begonia Level of soil per pot Pot 1 5 cm Pot 2 7 5 cm Pot 3 12 cm Pot 4 15 cm IV Level amount of soil in the different pots DV Amount of leaves on each branch of the plant within each pot Research Question How does the mass of soil affect the amount of leaves on each branch of a marigold plant Constant variables Watered evenly Same amount of sunlight Same location time span Directions Using the information above please write a few paragraphs answering the questions below in the format of an IB Biology IA Lab report Personal Significance Research question is based on authentic personal interest or curiosity Loignificance is not contrived for example I have always beer

Photosynthesis

Photosynthesis Making Energy Plate Call Chloropfent Chloroplasts Photosynthesis is a process in which sunlight energy is used to make glucose The site of photosynthesis is in the chloroplast an organelle found in the leaves of green plants The main functions of chloroplasts are to produce food glucose during photosynthesis and to store food Stena LAINWONE 1 What is photosynthesis www Over 2 Where does photosynthesis occur 3 What are chloroplasts and where are they found Stra Thysod energy Chloroplasts contain the pigment chlorophyll Chlorophyll absorbs most of the colors in the color spectrum and reflects only green and yellow wavelengths of light This is why we see leaves as green or yellow because these colors are reflected into our eyes 4 What are the two main functions of chloroplasts 5 Why do most leaves appear green What is the primary pigment found in the chloroplast wecare Space Gracem luch of Thylaciti

Was the Columbian Exchange

DNA Replication Labeling with word bank DNA polymerase 5 DNA Ligase Okazaki fragment DNA Primase Single Strand Binding Leading Strand Lagging Proteins Strand 5 3 Helicase RNA primer OTTY Mys Ox 3 5 Topoisomerase

Enzyme that unwinds DNA Fragments of copied DNA created on the lagging strand The strand that is copied in a continuous way from the 3 to 5 direction Binds Okazaki fragments Builds a new DNA strand by adding complementary bases Stabilizes the DNA molecule during replication Strand that is copied discontinuously because it is traveling away from helicase Initiates the synthesis DNA by creating a short RNA

Place the events in the correct order DNA polymerase adds nucleotides in the 5 to 3 direction Replication fork is formed DNA polymerase attaches to the primer Okazaki fragments are bound together by ligase

e 155 156 159 160 8 3 Describe a genotype and phenotype of a genetic carrier and use this term appropriately Drag each correct term to complete the passage Drag word s below to fill in the blank s in the passage Some genetic disorders are said to skip a generation but they are present in a parent known as a by another allele The only who has a copy of the allele for the disorder that is disorders that cannot be inherited in this way are in disorders that are only one parent the can pass on the disorder without expressing it

How does the Mealy Blue Sage get energy

Question 1 0 25 p In the reaction 6CO2 6H 20 C 6H 120 6 60 2 which side should energy be placed on the right side this is an endergonic reaction neither side the reaction is in equilibrium O the right side this is an exergonic reaction the left side this is an exergonic reaction the left side this is an endergonic reaction

substance as an acentuar fuld an extracellular fluid a solute in body fluids or neither a body fluid nor a solute Drag the appropriate items to their respective bins View Available Hint s lymph Intracellular fluid interstitial fluid water soluble proteins Extracellular fluid plasma whole blood red blood cells Solute in body fluids glucose electrolytes Reset Neither fluid nor solute Help

What is the main difference between a hormone and a neurotransmitter Check all that apply ONeurotransmitters act rapidly and with short duration whereas hormones act more slowly and produce effects of longer duration A neurotransmitter transmits a chemical message from an endocrine gland to a target tissue A hormone carries an impulse between neighboring nerve cells A neurotransmitter carries an impulse between neighboring nerve cells O A hormone transmits a chemical message from an endocrine gland to a target tissue Hormones act rapidly and with short duration whereas neurotransmitters act more slowly and produce effects of longer duration

O fungi can digest rock and turn it into soil that allowed for the movement of plants to land Ofungi can photosynthesize Question 19 Which of the following were used as scientific evidence to support the idea that Prototaxites was a giant fungus and not a plant Select all that apply It produced relatively small amounts of pollen It had lopsided rings that were determined to be hyphae It was determined to have cell walls made of chitin 0 5 p It had carbon icet

It was determined to have cell walls made of chitin It had carbon isotope ratios that were more similar to those found in fungi and animals than plants Question 20 How do fungi help plants live on land Select all that apply COD They help stabilize the roots in the soil They help the plants retain moisture They help the plants get and retain nitrogen They provide sugars via photosynthesis to the plant

0 Number of plants 30 25 20 5 0 a Wt An b VF Treatments NS Legend All plants were exposed to heat stress Wt wild type plants that have the normal fungal symbiont and the fungus has the normal viral infection An plants that originally did not have the fungal symbiont with the normal viral infection but it was added at the start of the experiment VF virus free plants in which the viral symbiont were removed from the fungus NS nonsymbiotic plants that had the fungal symbiont removed Chlorotic a condition in plants in which leaves produce insufficient chlorophyll NS Dead Chlorotic Healthy This graphic summarizes the results of a study looking at the role of a virus in the ability of the fungus Curvularia protuberata to confer heat tolerance in panic grass This virus normally infects C protuberata Which of the following statements best summarizes the results of this experiment O Plants that have C protuberata removed have greater heat tolerance than those that retain the fungus The presence of the virus reduces the fungus ability to confer heat tolerance on the plants The ability of the fungus to confer heat tolerance on the plants relies on a viral symbiont

In the video the interviewer asks the scientist if he has concerns about infecting crop plants with fungi because some fur produce toxins What is the correct term to refer to fungal toxins Rusts Mildew Fungitoxins