Biotechnology: Principles and Processes Questions and Answers
![C Protein glycosylation D Alpha helix formation 38 Certain bacteria synthesize toxic proteins which are responsible for many of the problems they cause in humans If you were to develop a drug designed to inhibit bacterial protein synthesis without interfering with normal human protein synthesis what might be a logical target for the drug Choose one of the following A RNA B Ribosomes C Golgi apparatus D DNA 39 A nonsense mutation has occurred in the DNA segment which codes for protein A After it has been transcribed and translated what is the most likely product formed from this mutated region Choose one of the Following A A small truncated nonfunctional protein A B A product that differs in only a single amino acid from protein A C A product that differs in only a single base pair from protein A but with entirely different amino acids D A normally shaped fully functional protein A Can the change of a protein shape cause changes in function True or false Protein shape can inhibit protein function true or false When cellular ATP is low glucoses are broken down true or false](https://media.kunduz.com/media/sug-question-candidate/20231212201237924576-6116568.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesC Protein glycosylation D Alpha helix formation 38 Certain bacteria synthesize toxic proteins which are responsible for many of the problems they cause in humans If you were to develop a drug designed to inhibit bacterial protein synthesis without interfering with normal human protein synthesis what might be a logical target for the drug Choose one of the following A RNA B Ribosomes C Golgi apparatus D DNA 39 A nonsense mutation has occurred in the DNA segment which codes for protein A After it has been transcribed and translated what is the most likely product formed from this mutated region Choose one of the Following A A small truncated nonfunctional protein A B A product that differs in only a single amino acid from protein A C A product that differs in only a single base pair from protein A but with entirely different amino acids D A normally shaped fully functional protein A Can the change of a protein shape cause changes in function True or false Protein shape can inhibit protein function true or false When cellular ATP is low glucoses are broken down true or false
![An allele that if present is always expressed is called a recessive allele True False A n allele is the offspring of two different true breeding plants True 4 False 1 point point](https://media.kunduz.com/media/sug-question-candidate/20231212185826172369-4553535.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesAn allele that if present is always expressed is called a recessive allele True False A n allele is the offspring of two different true breeding plants True 4 False 1 point point
![I have taken four good professors at this college Mr Smith Mrs Ortiz Dr Willard and Ms Richard therefore I can conclude that the professors at this college are good This is an example of which type of reasoning cause reasoning O comparison reasoning Osign reasoning example reasoning](https://media.kunduz.com/media/sug-question-candidate/20231212062923718549-6362990.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesI have taken four good professors at this college Mr Smith Mrs Ortiz Dr Willard and Ms Richard therefore I can conclude that the professors at this college are good This is an example of which type of reasoning cause reasoning O comparison reasoning Osign reasoning example reasoning
![9 Stem cells are](https://media.kunduz.com/media/sug-question-candidate/20231211235116231591-3718919.jpg?w=256)
![5 What is one advantage of using transgenic plant cells to produce human proteins for hormone replacement therapy Plant cells are less expensive to grow than other cell types O HIV is spread through proteins harvested from transgenic animals O Transgenic animals cannot produce human proteins Transgenic plants produce lower protein yields than transgenic animals](https://media.kunduz.com/media/sug-question-candidate/20231211234953615194-3718919.jpg?w=256)
Biology
Biotechnology: Principles and Processes5 What is one advantage of using transgenic plant cells to produce human proteins for hormone replacement therapy Plant cells are less expensive to grow than other cell types O HIV is spread through proteins harvested from transgenic animals O Transgenic animals cannot produce human proteins Transgenic plants produce lower protein yields than transgenic animals
![4 During gel electrophoresis DNA fragments are separated by size O True False](https://media.kunduz.com/media/sug-question-candidate/20231211234927235157-3718919.jpg?w=256)
Biology
Biotechnology: Principles and Processes4 During gel electrophoresis DNA fragments are separated by size O True False
![In recombinant DNA techniques the gaps in the paired DNA fragments are closed by O DNA ligase O Restriction Enzyme O DNA replicase O DNA Polymerase](https://media.kunduz.com/media/sug-question-candidate/20231211234909114105-3718919.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesIn recombinant DNA techniques the gaps in the paired DNA fragments are closed by O DNA ligase O Restriction Enzyme O DNA replicase O DNA Polymerase
![2 Plasmids are short sequences of DNA used as primers in PCR O False O True O](https://media.kunduz.com/media/sug-question-candidate/20231211234839194149-3718919.jpg?w=256)
Biology
Biotechnology: Principles and Processes2 Plasmids are short sequences of DNA used as primers in PCR O False O True O
![1 A restriction enzyme is a O bacterial enzyme that cuts DNA at specific sites O viral enzyme that randomly cuts DNA bacterial enzyme that functions in DNA replication O Single stranded RNA molecule](https://media.kunduz.com/media/sug-question-candidate/20231211234814053272-3718919.jpg?w=256)
Biology
Biotechnology: Principles and Processes1 A restriction enzyme is a O bacterial enzyme that cuts DNA at specific sites O viral enzyme that randomly cuts DNA bacterial enzyme that functions in DNA replication O Single stranded RNA molecule
![A horse eating some hay is an example of an autotroph eating a producer an autotroph eating a consumer a consumer eating a producer O O a consumer eating a heterotroph](https://media.kunduz.com/media/sug-question-candidate/20231211031053344591-4754400.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesA horse eating some hay is an example of an autotroph eating a producer an autotroph eating a consumer a consumer eating a producer O O a consumer eating a heterotroph
![8 Golden rice contains a transgene that allows for increased production of vitamin A a b True False](https://media.kunduz.com/media/sug-question-candidate/20231210051533936872-3718919.jpg?w=256)
Biology
Biotechnology: Principles and Processes8 Golden rice contains a transgene that allows for increased production of vitamin A a b True False
![If employment and output are at their lowest levels an expansion in the business cycle is occurring cyclical unemployment is occurring a trough in the business cycle is occurring a peak in the business cycle is occurring](https://media.kunduz.com/media/sug-question-candidate/20231209023546498897-4426152.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesIf employment and output are at their lowest levels an expansion in the business cycle is occurring cyclical unemployment is occurring a trough in the business cycle is occurring a peak in the business cycle is occurring
![What is NOT the correct statement of inflation demand pull inflation comes from too much money relative to output inflation reduces the purchasing power or value of money fixed income receivers benefit from inflation core inflation measures the price changes of consumers goods and services except food and energy](https://media.kunduz.com/media/sug-question-candidate/20231209023854656959-4426144.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesWhat is NOT the correct statement of inflation demand pull inflation comes from too much money relative to output inflation reduces the purchasing power or value of money fixed income receivers benefit from inflation core inflation measures the price changes of consumers goods and services except food and energy
![What are determined in AD AS model Oreal GDP and nominal GDP the price level CPI and aggregate demand the price level CPI and aggregate supply real GDP and the price level CPI](https://media.kunduz.com/media/sug-question-candidate/20231209023257179225-4426152.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesWhat are determined in AD AS model Oreal GDP and nominal GDP the price level CPI and aggregate demand the price level CPI and aggregate supply real GDP and the price level CPI
![If the national incomes of our trading partners increase then our aggregate demand increases because net exports increase increases because consumption increases decreases because net exports decrease decreases because consumption decreases](https://media.kunduz.com/media/sug-question-candidate/20231209023226654640-4426152.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesIf the national incomes of our trading partners increase then our aggregate demand increases because net exports increase increases because consumption increases decreases because net exports decrease decreases because consumption decreases
![H T H C OHA 1 6 0 CH 2 Ethanol 2 NAD 2 NADH 2 H Alcohol fermentation used by animal cells Ethanol fermentation generates ethanol 2 Pyruvic acid 2 CO H T CO is lost C O CH 2 Acetaldehyde Both Answer Bank 2 NAD C O H C OHA CH 2 Lactate 2 NADH regenerates NAD that can be used in glycolysis 2 H 2 Pyruvic acid Lactic acid fermentation No loss of CO Lactic acid fermentation used by yeast cells](https://media.kunduz.com/media/sug-question-candidate/20231209021441217488-5870066.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesH T H C OHA 1 6 0 CH 2 Ethanol 2 NAD 2 NADH 2 H Alcohol fermentation used by animal cells Ethanol fermentation generates ethanol 2 Pyruvic acid 2 CO H T CO is lost C O CH 2 Acetaldehyde Both Answer Bank 2 NAD C O H C OHA CH 2 Lactate 2 NADH regenerates NAD that can be used in glycolysis 2 H 2 Pyruvic acid Lactic acid fermentation No loss of CO Lactic acid fermentation used by yeast cells
![Cellular respiration is carried out in the presence of oxygen aerobic conditions or the absence of oxygen anaerobic conditions Determine whether each event occurs under aerobic conditions anaerobic conditions or both aerobic and anaerobic conditions Aerobic conditions fermentation glycolysis Anaerobic conditions electron transport chain Answer Bank citric acid cyme Krebs cycle Both](https://media.kunduz.com/media/sug-question-candidate/20231209021309261720-5870066.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesCellular respiration is carried out in the presence of oxygen aerobic conditions or the absence of oxygen anaerobic conditions Determine whether each event occurs under aerobic conditions anaerobic conditions or both aerobic and anaerobic conditions Aerobic conditions fermentation glycolysis Anaerobic conditions electron transport chain Answer Bank citric acid cyme Krebs cycle Both
![QUESTION 39 Plants that show a pattern of stomatal opening and closing that is the reverse of C3 plants are called O C4 Temperate O CAM O Calvin cycle QUESTION 40 If the gene encoding the enzyme rubisco is mutated such that it is non functional the process that would be affected is the ability to O make ATP O harvest photons Ofix carbon O make 02 make NADPH](https://media.kunduz.com/media/sug-question-candidate/20231206062948011208-4348260.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesQUESTION 39 Plants that show a pattern of stomatal opening and closing that is the reverse of C3 plants are called O C4 Temperate O CAM O Calvin cycle QUESTION 40 If the gene encoding the enzyme rubisco is mutated such that it is non functional the process that would be affected is the ability to O make ATP O harvest photons Ofix carbon O make 02 make NADPH
![Translocation is the process where the t RNA in the A site moves into the P site O True O False](https://media.kunduz.com/media/sug-question-candidate/20231130140320248709-3610613.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesTranslocation is the process where the t RNA in the A site moves into the P site O True O False
![During DNA synthesis the enzyme that continuously synthesizes the DNA is Primase O DNA Polymerase 1 ODNA Polymerase 3 DNALigase](https://media.kunduz.com/media/sug-question-candidate/20231130140311127464-3610613.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesDuring DNA synthesis the enzyme that continuously synthesizes the DNA is Primase O DNA Polymerase 1 ODNA Polymerase 3 DNALigase
![Succeeding in biotech entrepreneurship and innovation requires a solid life sciences foundati Build a strong foundation through Work experience Research experience](https://media.kunduz.com/media/sug-question-candidate/20231127175139948467-4426144.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesSucceeding in biotech entrepreneurship and innovation requires a solid life sciences foundati Build a strong foundation through Work experience Research experience
![QUESTIONS ONA Rejan Uses light Untwists strands Relives torque 12 11 2 Holds open Damage 13 Cut out damage 1 DNA strand Attachment for enzyme 10 Replicates lagging end 4 Reads copies DNA 5 Continuous assembly 6 Discontinuous assembly Fragments 8 00 7 Links fragments A RNA primer Telomerase C DNA se D Oyras E Excision repair FDNA polymerase GMutation Single stranded binding proteine Photo repair Leading strand K Okazaki L Helcase MLagging strand](https://media.kunduz.com/media/sug-question-candidate/20231127181500026331-4348260.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesQUESTIONS ONA Rejan Uses light Untwists strands Relives torque 12 11 2 Holds open Damage 13 Cut out damage 1 DNA strand Attachment for enzyme 10 Replicates lagging end 4 Reads copies DNA 5 Continuous assembly 6 Discontinuous assembly Fragments 8 00 7 Links fragments A RNA primer Telomerase C DNA se D Oyras E Excision repair FDNA polymerase GMutation Single stranded binding proteine Photo repair Leading strand K Okazaki L Helcase MLagging strand
![2 What are the possible phenotypes of the offspring of a pea plant with white axial heterozygous flowers heterozygous and a pea plant with violet heterozygous terminal flowers If 100 pea plants are produced how many would have each of the possible phenotypes 3 points](https://media.kunduz.com/media/sug-question-candidate/20231124224421654290-3865561.jpg?w=256)
Biology
Biotechnology: Principles and Processes2 What are the possible phenotypes of the offspring of a pea plant with white axial heterozygous flowers heterozygous and a pea plant with violet heterozygous terminal flowers If 100 pea plants are produced how many would have each of the possible phenotypes 3 points
![For questions 1 and 2 refer to the chart of pea plant traits in your lecture book 1 What are the possible genotypes and phenotypes of the offspring of a pea plant with full pods heterozygous and a pea plant with constricted pods Give the probabilities for each possibility 2 points](https://media.kunduz.com/media/sug-question-candidate/20231124224401154083-3865561.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesFor questions 1 and 2 refer to the chart of pea plant traits in your lecture book 1 What are the possible genotypes and phenotypes of the offspring of a pea plant with full pods heterozygous and a pea plant with constricted pods Give the probabilities for each possibility 2 points
![The structure of human insulin includes disulfide bridges averaging every 6 amino acid pairs includes both an alpha and a beta helix is characterized by being a large molecule with a complex three dimensional structure None of these Question 4 A solution has OH 5 2 x 10 4 M The pH of this solution is 3 28 1 92 10 11 5 36 10 72 2 pts](https://media.kunduz.com/media/sug-question-candidate/20231121051031785265-5971119.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesThe structure of human insulin includes disulfide bridges averaging every 6 amino acid pairs includes both an alpha and a beta helix is characterized by being a large molecule with a complex three dimensional structure None of these Question 4 A solution has OH 5 2 x 10 4 M The pH of this solution is 3 28 1 92 10 11 5 36 10 72 2 pts
![Starting with acetyl S enzyme 1 and malonyl CoA how many molecules of acetyl CoA are needed to synthesize an 20 carbon fatty acid C20 0 Express your answer as an integer Nacetyl CoA 8 Submit Previous Answers Correct Part B How many molecules of CO are released in this process Express your answer as an integer VAX C P](https://media.kunduz.com/media/sug-question-candidate/20231117225303771308-3671786.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesStarting with acetyl S enzyme 1 and malonyl CoA how many molecules of acetyl CoA are needed to synthesize an 20 carbon fatty acid C20 0 Express your answer as an integer Nacetyl CoA 8 Submit Previous Answers Correct Part B How many molecules of CO are released in this process Express your answer as an integer VAX C P
![an example of phagocytosis clathrin coated pit formation Oregulated secretion constitutive secretion epithel Lysosome Endosome Endoplasmic reticulum cells lining the respiratory tract is Question 4 0 5 points 4 Listen In which of the following organelles would you expect to first find a protein destined to be secreted from a cell](https://media.kunduz.com/media/sug-question-candidate/20231117233639621252-4426144.jpg?w=256)
Biology
Biotechnology: Principles and Processesan example of phagocytosis clathrin coated pit formation Oregulated secretion constitutive secretion epithel Lysosome Endosome Endoplasmic reticulum cells lining the respiratory tract is Question 4 0 5 points 4 Listen In which of the following organelles would you expect to first find a protein destined to be secreted from a cell
![5 Your lab partner arrived late to class on the day you started your fetal pig dissec tion You ve already selected a male pig for your dissection and you want your partner to choose a female Describe how your partner can recognize and select a female pig from the container Be specific](https://media.kunduz.com/media/sug-question-candidate/20231116223307693613-5889884.jpg?w=256)
Biology
Biotechnology: Principles and Processes5 Your lab partner arrived late to class on the day you started your fetal pig dissec tion You ve already selected a male pig for your dissection and you want your partner to choose a female Describe how your partner can recognize and select a female pig from the container Be specific
![6 Male pattern baldness is a recessive sex linked trait on the X chromosome A woman whose father had male pattern baldness marries a man with this trait What is the probability that any son born will have pattern baldness 7 In humans normal skin color A is dominant over albino a A diabetic albino man marries a normal woman whose mother was an albino and whose father was diabetic What are the genotypes of the man and the woman What proportion of their children would be expected to be both non diabetic and have normal color 8 A person with Rh blood has a specific protein in his her blood Persons with Rh blood do not have this particular protein in their blood Rh is dominant to Rh Also normal insulin production dominates abnormal insulin production If two individuals are heterozygous for Rh and normal insulin production what probable phenotypes might thain ohildran ha](https://media.kunduz.com/media/sug-question-candidate/20231116072143376429-4144409.jpg?w=256)
Biology
Biotechnology: Principles and Processes6 Male pattern baldness is a recessive sex linked trait on the X chromosome A woman whose father had male pattern baldness marries a man with this trait What is the probability that any son born will have pattern baldness 7 In humans normal skin color A is dominant over albino a A diabetic albino man marries a normal woman whose mother was an albino and whose father was diabetic What are the genotypes of the man and the woman What proportion of their children would be expected to be both non diabetic and have normal color 8 A person with Rh blood has a specific protein in his her blood Persons with Rh blood do not have this particular protein in their blood Rh is dominant to Rh Also normal insulin production dominates abnormal insulin production If two individuals are heterozygous for Rh and normal insulin production what probable phenotypes might thain ohildran ha
![1 Primers and Base pairing 3 points Primers are usually approximately 20 nucleotides long For this activity we will use a 5 base pair primer Using this primer 5 GATAC 3 Show where the primer binds to your template DNA below Indicate the primer by using bold text Then act as the polymerase and fill in the rest of the new strand of DNA DNA polymerase can only add to the 3 M end of the new DNA strand New DNA strand Template DNA 3 3 TAGCTATGCGGACCTCATGCATTAGAGTA G 5 5](https://media.kunduz.com/media/sug-question-candidate/20231116013248499279-5904656.jpg?w=256)
Biology
Biotechnology: Principles and Processes1 Primers and Base pairing 3 points Primers are usually approximately 20 nucleotides long For this activity we will use a 5 base pair primer Using this primer 5 GATAC 3 Show where the primer binds to your template DNA below Indicate the primer by using bold text Then act as the polymerase and fill in the rest of the new strand of DNA DNA polymerase can only add to the 3 M end of the new DNA strand New DNA strand Template DNA 3 3 TAGCTATGCGGACCTCATGCATTAGAGTA G 5 5
![isten In the Rhodospirillum rubrum photosystem II bacteriochloropyll weak infrared wavelengths in the range O a p800 750 800 Ob P870 800 1 100 O c P700 700 750 d 40 500 can absorb](https://media.kunduz.com/media/sug-question-candidate/20231115034841373564-5917575.jpg?w=256)
Biology
Biotechnology: Principles and Processesisten In the Rhodospirillum rubrum photosystem II bacteriochloropyll weak infrared wavelengths in the range O a p800 750 800 Ob P870 800 1 100 O c P700 700 750 d 40 500 can absorb
![Explain these techniques a SDS PAGE b 2D SDS PAGE c Two color 2D SDS PAGE d Western Blot What are the limitations of Genomic and Function Genomic in comparison to Proteomics](https://media.kunduz.com/media/sug-question-candidate/20231115013023534994-6227938.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesExplain these techniques a SDS PAGE b 2D SDS PAGE c Two color 2D SDS PAGE d Western Blot What are the limitations of Genomic and Function Genomic in comparison to Proteomics
![What percentage of people admitted to the hospital for possible heart attacks in the United States are found not to have had a heart attack not that they shouldn t go the ER with chest pin none of the above 5 25 50 75](https://media.kunduz.com/media/sug-question-candidate/20231114011139453885-3652001.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesWhat percentage of people admitted to the hospital for possible heart attacks in the United States are found not to have had a heart attack not that they shouldn t go the ER with chest pin none of the above 5 25 50 75
![How do symbiotic bacteria play a role in keeping us healthy Select 3 correct answer s product cells that attack foreign invaders make our kin more basic so it is hospitable to other bacteria hijack our cells to reproduce themselves make our skin more acidic to reduce growth of other micro organisms produce proteins to help us build and repair tissue produce enzymes that help us digest food](https://media.kunduz.com/media/sug-question-candidate/20231114011032473475-3652001.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesHow do symbiotic bacteria play a role in keeping us healthy Select 3 correct answer s product cells that attack foreign invaders make our kin more basic so it is hospitable to other bacteria hijack our cells to reproduce themselves make our skin more acidic to reduce growth of other micro organisms produce proteins to help us build and repair tissue produce enzymes that help us digest food
![What will be the total number of molecules of NADH FADH2 and GTP that are synthesized if the citric acid cycle repeats 18 times Express your answers as integers separated by commas View Available Hint s AEO Number of NADH FADH GTP molecules 54 18 36](https://media.kunduz.com/media/sug-question-candidate/20231112232051282059-3671786.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesWhat will be the total number of molecules of NADH FADH2 and GTP that are synthesized if the citric acid cycle repeats 18 times Express your answers as integers separated by commas View Available Hint s AEO Number of NADH FADH GTP molecules 54 18 36
![osome the type of mutation is referred to as a duplication an inversion a translocation a nonsense mutation Question 10 1 point Saved Listen Strand slippage results in such as fragile X syndrome which can cause a number of human diseases pyrimidine dimer addition the re replication of highly repetitive DNA sequences EDNA](https://media.kunduz.com/media/sug-question-candidate/20231112134140811710-4426144.jpg?w=256)
Biology
Biotechnology: Principles and Processesosome the type of mutation is referred to as a duplication an inversion a translocation a nonsense mutation Question 10 1 point Saved Listen Strand slippage results in such as fragile X syndrome which can cause a number of human diseases pyrimidine dimer addition the re replication of highly repetitive DNA sequences EDNA
![Release factors of translation recognize the codon OUGA UUU OGUA](https://media.kunduz.com/media/sug-question-candidate/20231112133916355397-4426144.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesRelease factors of translation recognize the codon OUGA UUU OGUA
![Which of the following types of mutation resulting in an error in the mRNA just after the 5 AUG start codon is likely to have the most serious effect on the polypeptide product a substitution of the second nucleotide of a GGG codon a substitution of the third nucleotide in an ACC codon a substitution of the first nucleotide of a GGG codon a deletion of two nucleotides](https://media.kunduz.com/media/sug-question-candidate/20231112130954939473-4426152.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesWhich of the following types of mutation resulting in an error in the mRNA just after the 5 AUG start codon is likely to have the most serious effect on the polypeptide product a substitution of the second nucleotide of a GGG codon a substitution of the third nucleotide in an ACC codon a substitution of the first nucleotide of a GGG codon a deletion of two nucleotides
![The codon for phenylalanine is UUU Which of the following codons also most likely encodes for phenylalanine AAA UUC CUU](https://media.kunduz.com/media/sug-question-candidate/20231112131024785266-4426152.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesThe codon for phenylalanine is UUU Which of the following codons also most likely encodes for phenylalanine AAA UUC CUU
![Which of the following molecule s help s to hold the DNA strands apart while they are being replicated single strand binding proteins DNA polyermase primase](https://media.kunduz.com/media/sug-question-candidate/20231112130900655808-4426152.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesWhich of the following molecule s help s to hold the DNA strands apart while they are being replicated single strand binding proteins DNA polyermase primase
![Which of the following is not a true statement regarding the genetic code The genetic code is nonoverlapping The genetic code is degenerate The genetic code is nearly universal with only a few minor exceptions Each codon represents a different amino acid](https://media.kunduz.com/media/sug-question-candidate/20231112130734849769-4426152.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesWhich of the following is not a true statement regarding the genetic code The genetic code is nonoverlapping The genetic code is degenerate The genetic code is nearly universal with only a few minor exceptions Each codon represents a different amino acid
![Ran GTP gradient is maintained by Onucleoskeleton GEF outside the nucleus O GAP inside the nucleus O GEF inside the nucleus](https://media.kunduz.com/media/sug-question-candidate/20231112130804228595-4426152.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesRan GTP gradient is maintained by Onucleoskeleton GEF outside the nucleus O GAP inside the nucleus O GEF inside the nucleus
![Introns are sequences that O code for proteins are methylated on the pre rRNA spliced out of the pre mRNA terminate RNA transcription](https://media.kunduz.com/media/sug-question-candidate/20231112123231309235-4426144.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesIntrons are sequences that O code for proteins are methylated on the pre rRNA spliced out of the pre mRNA terminate RNA transcription
![The transcription preinitation complex includes transcription factors and RNA polyermase on the promoter can be formed in the absence of a core promoter elongation can proceed without the preinitiation complex assembling first O includes the poly A tail and RNA polyermase on the promoter](https://media.kunduz.com/media/sug-question-candidate/20231112123245428447-4426144.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesThe transcription preinitation complex includes transcription factors and RNA polyermase on the promoter can be formed in the absence of a core promoter elongation can proceed without the preinitiation complex assembling first O includes the poly A tail and RNA polyermase on the promoter
![Match the testing method to the purpose Agarose gel electrophoresis Choose RFLP Microarray Technology Polyacrylamide gel electrophoresis PCR Southern Blot Northern Blot Choose Choose Choose Choose Choose Choose](https://media.kunduz.com/media/sug-question-candidate/20231111143520364651-5971119.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesMatch the testing method to the purpose Agarose gel electrophoresis Choose RFLP Microarray Technology Polyacrylamide gel electrophoresis PCR Southern Blot Northern Blot Choose Choose Choose Choose Choose Choose
![1 How do cells differentiate from each other from the same genome code](https://media.kunduz.com/media/sug-question-candidate/20231111014526599933-4426144.jpg?w=256)
Biology
Biotechnology: Principles and Processes1 How do cells differentiate from each other from the same genome code
![What are the roles of introns and exons and why is alternative splicing an important mechanism for these processes](https://media.kunduz.com/media/sug-question-candidate/20231106230427672218-4426144.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesWhat are the roles of introns and exons and why is alternative splicing an important mechanism for these processes
![Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags](https://media.kunduz.com/media/sug-question-candidate/20231102023910708633-4376984.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesComparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags
![Output Income 400 450 500 550 600 650 700 Consumption 200 225 250 275 300 325 350 Investment 150 150 150 150 150 150 150 Gov Spending 50 50 50 50 50 50 50 a What is the equilibrium level of output income b Suppose that government spending increase from 50 to 100 at each level of income What will happen to the equilibrium level of output income c Continued from the previous question b Given that Yf full employment level of output 500 describe the current economy Is there any inflation or unemployment issue](https://media.kunduz.com/media/sug-question-candidate/20231030154147434331-4426144.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesOutput Income 400 450 500 550 600 650 700 Consumption 200 225 250 275 300 325 350 Investment 150 150 150 150 150 150 150 Gov Spending 50 50 50 50 50 50 50 a What is the equilibrium level of output income b Suppose that government spending increase from 50 to 100 at each level of income What will happen to the equilibrium level of output income c Continued from the previous question b Given that Yf full employment level of output 500 describe the current economy Is there any inflation or unemployment issue
![Sample stream Light scatter and fluorescence detector Induces charge on selected droplets Laser Sorted samples Waste nonlabeled cells Cells labeled by FISH Nozzle Deflection plates de](https://media.kunduz.com/media/sug-question-candidate/20231030145550128036-4726552.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesSample stream Light scatter and fluorescence detector Induces charge on selected droplets Laser Sorted samples Waste nonlabeled cells Cells labeled by FISH Nozzle Deflection plates de