Biotechnology: Principles and Processes Questions and Answers

Biology
Biotechnology: Principles and Processes18 This chemical is an oxidizing agent A Benzalkonium B Ozone C Penicillin D Triclosan E Vesphene 19 This technique will completely sterilize a liquid by killing or removing all cells A Autoclaving B Desiccation C Flash pasteurization D Freezing E Osmotic pressure

Biology
Biotechnology: Principles and ProcessesConstituent C Is abortion a controlled medical procedure or a right to have terminate a family Where does your Representative you work for stand on the issue You choose the stance but keep re election in mind when addressing this issue What interest groups is the Representative attentive to in legislation need 2 and why Constituent D I am considering going through In Vetro Fertilization IVF Will this SCOUTS ruling affect my use of the procedure when a few eggs are fertilized but not used What if I want to not choose an egg in IVF cause it has Downs Syndrome Will I be breaking the law in Texas or will the SCUTUS ruling prevent affective use of IVF in egg storage or denial you will have to medically research this and use in text citations to answer this Guidelines 5 pages minimum Must use in text citation I grade heavy here Double spaced entire piece must be in paragraph form NO long direct quotes over 2 lines allowed must summarize Use APA style No abstracts please Must have a works cited page Number the pages please Title page and Works cited page are not part of the page count and No students are allowed to work together on it Grading 10 for missing pages 30 for missing in text citations at length 3 missing a spot needing an in text citation 5 for Missing a works cited piece as I should see a minimum of 5 cited sources in reference page you will need more based on the constituent section 2 for messed up citation points subtracted for improperly or failing to address each section Points subtracted for poor writing skill usually 2 and 5 for not using page numbers and your name in Header Footer of each page I do not grade politically or push an agenda while grading objective grading only

Biology
Biotechnology: Principles and Processes36 APC adenomatous polyposis coli gene is an example of a a Proto oncogene b Oncogene c Tumor Suppressor Gene d all of the above

Biology
Biotechnology: Principles and Processes12 RAS is commonly associated with many cancer s based on a identified loss of function mutations b identified hyperactive mutations c effects on p53 d none of the above

Biology
Biotechnology: Principles and ProcessesSE 6 SE 5 York College CUNY NAME Bio 301Sp2021B Final Exam 8 May 24 27 Multiple Choice 1 pt each 9 Short Answer 2 pt each 36 Q total 45 pts answer all Qs on Exam 17 18 A B C D E A B is most often used for fruit fly transgenesis RNAseg Microinjection of DNA into male pronucleus HIV 1 cloning vector P element Ti plasmid is where peptidyl transfer takes place during translation P site of 50S Large ribosomal subunit A site of 30S Small ribosomal subunit Aminoacyl tRNA synthetase C D E Site E mRNA termination codon SE 4 Describe PCR and why it is important to use a thermostable DNA polymerase How did nanofluidics and nanoimaging lead to the vastly increased throughput of NGS compared with automated Sanger sequencing What causes chronic myelogenous leukemia CML on the chromosome DNA protein level and cellular levels

Biology
Biotechnology: Principles and Processes26 binds to lac operator preventing transcription A Ubiquitin B Glucose C Allolactose D Cyclic GMP E Repressor 27 Histone acetylation and DNA methylation contribute to A genetic mutation B mitochondrial haplogroups C karyotype analysis D epigenesis

Biology
Biotechnology: Principles and ProcessesA the enzyme that cuts DNA into fragments B the sticky ends of an RNA fragment C antibiotic resistant colony D a plasmid used to carry insert lipid into a host cell E the enzyme that covalently joins insert to vector 6 Scrapie mad cow and Creutzfeld Jacob disease are all caused by A C vibrio B Influenza virus C Covid 19 D HIV 1 polyprotein E Prion proteins 7 Specific DNA segments obtained using PCR and a primer pair are A replicons B amplicons C exons D spliceosomes E introns

Biology
Biotechnology: Principles and Processes1 The best description of lysogeny by temperate bacteriophage is A mobile segments of DNA B tiny RNA molecules that infect plants C viral DNA integrates into the host genome D misfolded form of normal brain protein E DNA methylation a defense for bacteria against bacteriophage infection answer all Qs on Exam 2 The Covid19 genome is detected in a nasal swab from an infected patient by A microarray analysis B Northern blotting C Western blotting D Southern blotting E RT PCR

Biology
Biotechnology: Principles and ProcessesWhen a horse and donkey mate they produce a mule which is infertile This is an example of which of the following A postzygotic barrier B prezygotic barrier C gametic isolation

Biology
Biotechnology: Principles and ProcessesWhich sentence best describes how a species might become extinct A Environmental changes favor certain traits over others and those traits become more frequent B Two populations become isolated from each other and develop different traits over time C Populations decline to the point that diversity decreases and chances of adapting decrease D New individuals from the same species move into the habitat increasing competition among populations

Biology
Biotechnology: Principles and Processes2 Five Neurospora auxotrophic mutant strains were isolated None of the mutant strains grew on minimal medium but their ability to grow on minimal medium with the following compounds was discovered to be as follows indicates growth and indicates no growth Compound A Compound O Compound Mutant mut 7 mut 10 mut 23 mut 33 mut 40 Precursor Enzyme A Amino acid Z Enzyme B a In the biosynthesis pathway below fill in the boxes with the correct intermediates Enzyme C Enzyme D Amino acid

Biology
Biotechnology: Principles and Processesb With some strains of yeast fermentation stops before sugar is exhausted usually at an alcohol concentration in excess of 12 What is a plausible explanation Explain

Biology
Biotechnology: Principles and ProcessesSender 1 A C Receiver I B 0 Communication The plus and minus signs in the diagram denote a Signal strength and weakness b Successful and unsuccessful message transfer C Fitness benefits and costs d All of the above

Biology
Biotechnology: Principles and ProcessesIn the graph below the first exposure to a pathogen results in mark more than one Antibody concentration in blood Primary and Secondary Immune Responses First exposure to pathogen Subsequent exposure to same pathogen Primary immune response Time Secondary immune response a longer and milder immune response a much quicker immune response the likely development of memory B cells the person who will die soon 1

Biology
Biotechnology: Principles and ProcessesIf a virus resides within a person for an extended time several months or over a year it can evolve to form multiple strains within that single person True False

Biology
Biotechnology: Principles and ProcessesO Spyware O Adobe Flash Player Oracle Java Runtime Environment

Biology
Biotechnology: Principles and ProcessesUsing recombinant DNA technology a restriction enzyme O removes a specific gene from human DNA opens a bacterial plasmid O both a and b

Biology
Biotechnology: Principles and ProcessesWhat important tool is referred to as the scissors of biotechnology O gel electrophoresis O restriction enzymes O PCR O DNA Sequencing Previous

Biology
Biotechnology: Principles and ProcessesAn extra circular DNA molecule isolated from bacteria that is used in Biotechnology to manipulate genes is known as a n Retrovirus O Bacteriophage O Recombinant DNA O Reovirus Plasmid


Biology
Biotechnology: Principles and ProcessesPart 2 MRSA Screening A methicillin resistant Staphylococcus aureus MRSA screen is a test that looks for the presence of MRSA and no other pathogens It is primarily used to identify the presence of MRSA in a colonized person On a community level screening may be used to help determine the source of an outbreak On a national level additional testing may inform clinicians and researchers about the unique genetic characteristics of the strains of MRSA circulating in the community or health care setting A nasal swab is collected from the nares nostrils of an asymptomatic person and cultured put onto a special nutrient medium incubated and then examined for the growth of characteristic MRSA colonies A swab may be collected from a wound site or skin lesion of a person who has been previously treated for a MRSA infection and cultured similarly A screening culture identifies the absence or presence of MRSA and usually takes 1 to 2 days for a result When studying how bacteria respond to antibiotics the Kirby Bauer disk diffusion method is used In this technique discs containing antibiotics are placed on agar where bacteria are growing and the antibiotics diffuse out into the agar If an antibiotic stops the bacteria from growing we can see circular areas around the wafers where bacteria have not grown This area is called the zone of inhibition The diameter of these zones is measured as shown below 3 What methods would hospitals employ to eliminate MRSA from their facilities 4 What is a strain of bacteria How is it possible that some strains of Staphylococcus aureus can be harmless but others can be deadly You may need to google this 5 A young scientist suggests that a chemical found on the skin of frogs can be used as an antibiotic Explain how the Kirby Bauer disk technique could be used to support this hypothesis 6 Consider the data gathered from the frog skin experiment What conclusion would you draw from the data Site Frog Skin 0 1 2 3 Penicillin Amoxicillin Zone of Inhibition 5 1 2 cm 3 9 cm 3 6 cm

Biology
Biotechnology: Principles and ProcessesTRSTAMT 20YERE Which method would you use to collect the fingerprints Why

Biology
Biotechnology: Principles and ProcessesUpstream signifies the direction opposite to that traveled by RNA polymerase as it transcribes the gene while the downstream direction is the direction in which RNA polymerase moves during transcription O True False

Biology
Biotechnology: Principles and ProcessesAn attenuated virus vaccine often gives a strong immune response What is a potentially major drawback O It may actually cause disease in some people If a person has prior immunity to it it may not work It requires a large dose of the virus

Biology
Biotechnology: Principles and ProcessesDescribe the important factors to be taken into account when scaling up mammalian cell culture bioprocesses under the following headings a Anchorage dependant versus suspension cells b Bioreactor types c Key process parameters

Biology
Biotechnology: Principles and ProcessesYou transferred bacteria to a tube of broth the broth looks clear after incubation The transfer was NOT successful ie there is no bacteria in the broth O True False

Biology
Biotechnology: Principles and Processesit allows only gram positive bacteria to grow it allows only gram negative bacteria to grow bacteria that ferment lactose looks different from those that cannot ferment lactose on this media bacteria that ferment mannitol looks different from those that cannot ferment mannitol on this media

Biology
Biotechnology: Principles and ProcessesWhat genetic benefits does a worker ant receive from taking care of its siblings in the colony

Biology
Biotechnology: Principles and ProcessesWhich of the following behaviors is acceptable when introducing yourself in a business setting Firmly shaking the hand of the other person Making eye contact Telling the person your role in the company All of the above

Biology
Biotechnology: Principles and Processes12 Some researchers have claimed that group selection theory is required if we are to explain why people have the capacity to behave generously nicely and morally to other members of their group whereas the selfish side of human behavior has been caused by natural selection Why is this claim inaccurate

Biology
Biotechnology: Principles and ProcessesAny permanent alteration of the genotype of an organism is referred to as transformation For example if strain of brewer s yeast Saccharomyces cerevisiae lacks the genes necessary to synthesize the amino acic histidine abbreviation His it is unable to grow on medium without histidine One can transform cells of this Recipient strain using DNA from a wild type Donor strain to restore the ability to make histidine Shown below are partial results of such an experiment Minus signs indicate no growth and plus signs indicate growth What can you reasonably conclude from these results Sample Plate Donor cells Recipient cells no transformation Transformed Recipient cells His His The Donor cells were contaminated with Recipient cells so the results are inconclusive O This experiment was totally successful as all of the controls gave the expected result The Recipient cells were contaminated with Donor cells so the results are inconclusive The Recipient cells were contaminated with DNA so the results are inconclusive 4

Biology
Biotechnology: Principles and Processes2 Answer the following questions about HIV Your textbook powerpoint and this link will assist you in completing this question Imagine two different people have been infected with HIV Patient A s helper T cells have the CD4 and the CCR5 receptors on the surface and patient B s CD4 cells have the CD4 receptor but not the CCR5 receptor Explain how the HIV viral life cycle will be different in each patient and why 4pts

Biology
Biotechnology: Principles and ProcessesWhich of the following scenarios does the free body diagram below illustrate Tension Tension Weight A sign board supported by two strings O A rubber band stretched by a person O A door pulled by two applied forces A book falling off a table Complete Later Complete

Biology
Biotechnology: Principles and ProcessesA force F is applied horizontally to block 1 and assume the surfaces are frictionless What is the force exerted by block 1 on block 2 O O m2 m m2 m1 F m m m2 m F F

Biology
Biotechnology: Principles and ProcessesWhich of the following is a contact force O Electrostatic force O Magnetic force O Gravitational force O Frictional force

Biology
Biotechnology: Principles and ProcessesAssimilation is the process by which inorganic substances are incorporated into organic molecules 1 True 2 False

Biology
Biotechnology: Principles and ProcessesDarwin s Understanding Main Ideas Answer the following questions on a separate sheet of paper 1 Who was Charles Darwin and what did he do on the Beagle s voyage 2 What is evolution 3 Explain how the shape of a finch s beak is an example of an adaptation 4 When members of a species compete what do they compete for 5 What happens when species overproduce offspring 6 Suppose a variation makes an individual member of a species better adapted to its environment How might that variation affect the individual s reproduction 7 How does the environment select organisms 8 How do helpful variations accumulate in a species over time 9 Why can only traits controlled by genes be acted upon by natural selection

Biology
Biotechnology: Principles and ProcessesThe rho factor stops O transduction O translation O splicing O transformation O transcription

Biology
Biotechnology: Principles and ProcessesWhen a dairy farmer chooses to breed the cows that give the most milk in the herd the farmers are following the principle of OA acquired characteristics OB artificial selection C natural selection OD descent with modification

Biology
Biotechnology: Principles and ProcessesA An O referendum O initiative allows citizens to propose laws O impeachment O recall

Biology
Biotechnology: Principles and ProcessesAn ordinance is O a national law O a state law O a local law O either a national state or local law

Biology
Biotechnology: Principles and Processeswrote Das Kapital O Fredrick Engels O Karl Marx O Thomas Cooper O Robert Owen

Biology
Biotechnology: Principles and ProcessesQuestion 10 Points 1 Choose the correct answer Under leader Deng Xiaoping the communist government of China allowed O an independent media O other political parties to compete with the Communists some private business the adoption of a bill of rights Complete Later Complete

Biology
Biotechnology: Principles and ProcessesWhen are British national elections O At least every five years When the government falls by losing the support of the House of Commons On the first Tuesday of November every five years Once at least every five years or when the government falls by losing the support of the House of Commons

Biology
Biotechnology: Principles and Processes3 Given the guiding region of a single guide RNA sgRNA and the double stranded DNA dsDNA in the following picture Guiding region AACGGGCGCUGGGUCGGUUA Target dsDNA TGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAG ACCACGTTGCCCGCGACCCAGCCAATGCCGGTCCTGTC a Highlight the sequence in the target dsDNA which is specifically recognized by the sgRNA b In the dsDNA indicate the region where Cas9 would cut the target dsDNA 45 X bi lactose X y plasmid ot 0 1 1 10 lac 2 of mutation

Biology
Biotechnology: Principles and ProcessesWhich statement about recombination frequency is CORRECT A Recombination frequency is calculated dividing the number of affected individuals by the total number of individual B Recombination frequency is calculated dividing the total number of individuals by the total number of affected individuals OC Recombination frequency is calculated dividing the total number of individuals by the number of unaffected individuals D Recombination frequency is calculated dividing the total number of recombinant individuals by the total number of affected indivia OE Recombination frequency is calculated dividing the total number of recombinant individuals by the total number of individuals Reset Selection O

Biology
Biotechnology: Principles and ProcessesUsing the video link to Describe the 5 steps of playing Bocce Ball https youtu be Z3StMd Tbl4

Biology
Biotechnology: Principles and ProcessesIdentifying the Theme in Ellis Which best expresses the main theme of Ellis Island O Working hard is the surest way to succeed The new Empire was America O The dream of ownership is not for everybody O America was a land of possibility for many

Biology
Biotechnology: Principles and ProcessesWhich law prohibits discrimination against individuals with disabilities in employment OOSHA ADA

Biology
Biotechnology: Principles and ProcessesAn employer voluntarily makes up for his or her past discrimination by hiring workers from disadvantaged classes What is the employer s voluntary action known as Exoneration action Escheat action