Molecular Basis of Inheritance Questions and Answers

Cystic fibrosis is a recessive genetic disease caused by a mutation in the gene that encodes the CFTR protein, which transports chloride ions in and out of cells. Some populations have a relatively high rate of cystic fibrosis carriers, possibly because the mutation protects against severe dehydration in diseases like cholera or typhoid. What concept does this best illustrate? A. Pleiotropy B. Polygenic traits C. Genetic drift D. Heterozygote advantage Mark for review (Will be highlighted on the review page)

Which of the following base pairs is NOT complementary? Adenine-cytosine Cytosine-guanine Thymine-adenine Adenine-uracil

Fragments in lagging strand during DNA replication adenine antiparallel chainreaction cytosine deoxyribos Franklin helix hydrogen leading nucleotide nucleus Okazaki polymerase repair semiconservative

If the content of adenine (A) in a DNA molecule is 30%, then which of the following is also true? A, there is 20% cytosine (C) B. there is 20% guanine (G) C. there is 30% thymine (1) D. all the above are correct

Succinate dehydrogenase (SDH) assay will be used to identify the presence of mitochondria in the acquired fractions.SDH enzyme is: a) Involved in the electron transport chain and the Krebs cycle b) Embedded in the inner mitochondrial membrane (IMM) c) All of these d) Specific to the mitochondria

Use the genetic code table to answer these questions: (A)Please specify the RNA molecule, and the polypeptide (be mindful of directionality) that is generated from this fragment of DNA. The bottom strand indicated is the coding strand for this molecule. (B) which strand will RNA polymerase use as a template? 5'-CGGTGCAAAGCCCGCGGACAATCAAAGGCCCACCCAT-3' 3'-GCCACGITICGGGCGCCIGITAGITICCGGGIGGGTA-5' REMEMBER: 1. code is always read from 5' to 3' 2. RNA polymerase can only add rNTPs to a free 3'-OH end of a rNTP

15. Mr. and Mrs. Green just gave birth to fraternal twins. Unfortunately, the nurse mixed them up with 4 other babies. Doctor's took samples of DNA from all of the children. Who are Mr. and Mrs. Green's children?

Write the sequence of a strand of DNA replicated using the following base sequences as a template a. TCGAGAATCTCGATT b. CCGTATAGCCGGTAC

C₂H5OH ⇒ C₂H3OOH Ethanol ------> Acetic Acid Which of the following is true about this reaction? (Hint: The equation should have same number of. O on both sides to be balanced] This process occurs anaerobically. This process requires O2.

In fruit flies, the gene for white eyes is X-linked recessive. If a white eyed female is crossed with a red eyed male, what percentage of the males will have white eyes? Not enough information 0% 50% 100%

Scientists examined the folded structure of a purified protein resuspended in water and found that amino acids with nonpolar R groups were primarily buried in the middle of the protein, whereas amino acids with polar R groups were primarily on the surface of the protein. Which of the following best explains the location of the amino acids in the folded protein? Polar R groups on the surface of the protein can form ionic bonds with the charged ends of the water molecules. Polar R groups are too bulky to fit in the middle of the protein and are pushed toward the protein's surface Nonpolar R groups that cannot form hydrogen bonds with water are pushed into the middle of the protein. Nonpolar R groups from different parts of the protein form covalent bonds with each other to maintain the protein's structure.

Which of the following statements is/are CORRECT about excision repair? DNA polymerase seals the nick left in the sugar-phosphate backbone of repaired DNA strand DNA ligase forms the final phosphodiester bond endonuclease removes the damaged nucleotides found at the end the DNA molecule two choices

Travis and Marcy, a Caucasian couple, are pregnant with their first child. Travis has a prior child with cystic fibrosis (autosomal recessive). He has refused to pursue carrier testing but Marcy has had negative carrier testing. Note: Carrier testing can identify 90% of carriers of CF accurately and approximately 1/25 Caucasian's are carriers of CF. What is the chance they will have a child with CF? 1/140 1/25 1/964

If the following snippet of mRNA is translated, what sequence of amino acids would be produced? (Hint: Use a codon table to help find the answer.) mRNA: 5'-GCGACU-3' Ala-Thr Ser-Ala Arg. Ser-Arg

What type of mutation involves a small part of the DNA sequence that is copied and added, with the result that the gene grows larger with every generation?

Isoforms are different versions of proteins that reflect different exon combinations. the patterns of acetyls, phosphates, and methyl groups that bind to a particular gene. different types of RNA molecules. technologies that sequence DNA at very low temperatures.

Ensures that mistakes during DNA replication are corrected adenine antiparallel chainreaction cytosine deoxyribose Franklin helix hydrogen leading nucleotide nucleus kazaki polymerase repair semiconservative

Which of the following can form a pyrimidine dimer A DNA sequence with a guanine followed by a guanine. A DNA sequence with a guanine followed by a thymine. A DNA sequence with a thymine followed by an adenine. A DNA sequence with a cytosine followed by a thymine.

The frequency of allele R in an isolated population of 200 outcrossing grasses (no inbreeding) is 0.2. Immigrants from a population with a frequency of R = 0.5 are introduced at a rate of one new immigrant per generation. Assuming no other evolutionary processes and one-way gene flow, what will be the equilibrium frequency of R in the isolated population after many years (rounded to 3 decimal places)? 0.205 1.000 0.500 0.600

If mRNA has the codon AGU, what tRNA anti-codon will match with it in the ribosome? (Enter the anti-codon answer as three capital letters with no spaces or dashes between them.)

Select the correct answer. Which mutation does the given change in nucleotide sequence represent? ATTGCATC → ATACGTTC A translocation B. substitution C. inversion D. duplication

What is true about the lagging strand during DNA replication? It is synthesized in the 5' to 3' direction. It is synthesized before the leading strand. It has the same sequence as the leading strand. It contains Okazaki fragments.

1. A strand of DNA in a skin cell contains the bases: A-T-G-C-C-A-T-C-G-G-T-A After the cell is exposed to ultraviolet light, the strand contains the bases: A-T-G-G-C-C-A-T-C-G-G-T-A Which statement describes the result of this exposure? (1) A new base has been inserted. (2) A base has been deleted. (3) One base has been substituted for another. (4) There have been no changes in the bases.

Amino acids have an amino group, a R group, a hydrogen and a carboxylic acid group attached to a central carbon. Amino acids differ only in their R groups. Circle the R groups in the following amino acids. NAME Glycine ABBREVIATION Gly

The _ allele masks the other allele it is paired with. A. recessive B. biggest C. most common D. dominant

The structure of enzymes that just includes folding AND twisting is called a secondary structure. A. beta pleat B. alpha helix C. theta helix

Below is a sequence of DNA on the CSF1PO locus. CCTATCATGTAGTCAGGTACTGGACGGGTATGGTATGGTATGGTATGGTATGGTATGGTATGGTATAATCCGAGATGGA A) What is the STR region in the above DNA sequence? B) How many repeats does it have?

Approximately half of all human cancers have defective p53. In these cancers, what else is commonly be observed? Increased p21 expression and decreased DNA mutations. Increased p21 expression and increased DNA mutations. Decreased p21 expression and increased DNA mutations. Decreased p21 expression and decreased DNA mutations.

If the haploid number for an organism is 24, the diploid number would be A. 72 C. 12 B. 24 D. 48

In the fruit fly, vestigial wings (small and useless) and ebony (black) body colour are produced by two recessive genes located on different chromosomes. The normal alleles, long wings and grey body colour, are dominant. What offspring would be expected if a vestigial-winged ebony male is crossed with a homozygous normal female? If the F, from this cross were permitted to mate randomly among themselves, what offspring would be expected in the F₂?

During prophase, original maternal and paternal chromatids are matched up with ____. A. their copies C. chromatin B. different contromeres D. the mitotic spindle

2. Sickle Cell disease can result from a single mutation in the above DNA sequence. The underlined thymine above is changed to a C below. Transcribe this section of DNA into mRNA and then translate the mRNA into the correct sequence of amino acids. Answer the question below. Mutated DNA: TAC CCT GAC TGA GGA CCC CTC TTC AGA mRNA: AUG GGA CUG ACU CCU GGA GAG AAG ARG amino acid sequence: MET, GLY, LEU, THR, PRO, GLY, GLU, LYS, ARG What happens to the amino acid sequence because of this change from a T to a C?

Phenylketonuria is a rare genetic disorder that is caused by a mutation in the PAH gene. This gene normally codes for the production of an enzyme that breaks down phenylalanine (found in food). Patients with the disorder have a toxic level of phenylalanine in their bodies which causes intellectual disability and seizures. Which of the following best explains why the mutation causes the severe symptoms? A nonsense mutation interferes with the production of phenylalanine A silent mutation impairs the enzyme's function due to improper folding A frameshift mutation impairs the enzyme's function de to improper folding A missense mutation causes too many copies of the enzyme to be transcribed

Why do you think the eukaryotic DNA requires multiple origins of replication? A. Multiple origins help make more copies of the same DNA simultaneously. B. Eukaryotic organisms have unique DNA strands for each specialized cell. C. Eukaryotes do not have topoisomerase, so multiple origins are created due to tension from unwinding of DNA strands. D. Eukaryotic DNA is much larger and replication at multiple origins helps reduce the time required for whole genomes to replicate. E. Multiple origins of replication ensure that there are no lagging strands and replication takes place at the same pace.

When biologists speak of a UNIVERSAL GENETIC CODE they are referring to the fact that, in nearly all organisms: A. The DNA sequences are identical B. RNA information is transcribed C. RNA specifies proteins the same way in all organisms D. Phenotype is dependent upon genotype

(Pierce worked problem) Suppose that a consensus sequence in the regulatory promoter of a eukaryotic gene that encodes enzyme A was deleted. Which of the following effects would result from this deletion? Explain your reasoning. A) Enzyme A would have a different amino acid sequence. B) The mRNA for enzyme A would be abnormally short. C) Enzyme A would be missing some amino acids. D) The mRNA for enzyme A would be transcribed but not translated. E) The amount of mRNA transcribed would be affected.

In the 1920s, a dye (now called Feulgen stain) was developed that bound DNA in direct proportion to the amount of DNA present in cells. Upon binding, the DNA would gain in color intensity. This DNA staining technique A) provided circumstantial evidence that DNA is the genetic material. B) definitively proved that DNA is the genetic material. C) demonstrated that all species have the same amount of nuclear DNA. D) confirmed that DNA is an important component of mitochondria and chloroplasts. E) led to skepticism that DNA is the genetic material.

If a single bacterial cell that is sensitive to the antibiotic vancomycin is placed in a grown medium that contains vancomycin, it will die. Now consider another single bacterial cell, also sensitive to vancomycin, that is allowed to divide for many generations to become a larger population. If this population is placed into vancomycin-containing growth medium, some of the bacteria will not die, and indeed, they will grow. Why do you see growth in this case, but not with the transferred single cell?

If, in humans, the DNA sequence TTTCTAGGAATA encodes the amino acid sequence LYS-ASP-PRO-TYR, what amino acid sequence will that same sequence specify in bacteria? Explain the evolutionary significance of this.

Given the DNA sequence below, write out the nucleotides for the complementary mRNA segment that would be created as a result of transcription. 3' AGT TTA CGG 5' 5'.........................3'

Answer the following using complete sentences. a) How did Mendel's work gradually gain acceptance. b) Describe how a cross between two closely related organisms may result in genetic problems. c) Are there any advantages in breeding organisms from closely related species? Explain.

Geneticists have discovered the existence of meiotic drive genes, which have alleles that, when present in a heterozygous state, are able to become incorporated into much more than 50 percent of the gametes. As a result, the offspring ratios are not what Mendel would have predicted. Which statement about these meiotic drive genes is true? A) They violate the law of independent assortment. B) They violate the law of equal segregation. C) They alter dominance relationships. D) They alter phenotypes. E) They are an example of blending inheritance.

A large population of animals is genotyped for many SNP loci across the nuclear genome. A high level of polymorphism is found at SNP loci over most of the genome. But on one chromosome, a particular long haplotype (a set of specific SNP alleles) is found at high frequency, and is homozygous in many individuals. Which of the following circumstances could help explain this situation? Select all correct answers; partial negative scoring for incorrect answers. A) The chromosome carries a transmission ratio distortion system. B) The chromosome has a higher mutation rate than the rest of the genome. C) The chromosome carries an allele that was recently subject to strong positive selection. D) The chromosome carries an inversion relative to other homologous chromosomes in the population. E) The population was subject to a recent bottleneck and founder effect. F) The chromosome was recently introduced from a different species.

Which kind of genetic element has repeated DNA with units composed of 2 to 6 nucleotides, copied from a few to about 100 times? (A) minisatellite (B) intron (C) microsatellite (D) transposon (E) satellite

Chloramphenicol binds to the 50S subunit of a 70S ribosome, which will interfere with... Transcription in prokaryotic cells Transcription in eukaryotic cells Translation in prokaryotic cells Translation in eukaryotic cells DNA synthesis

According to the video "The antibiotic apocalypse explained", what caused an increased bacterial resistance to the antibiotic colistin in China? Colistin was an OTC (over-the-counter) medicine and people abused its use Farmers were treating animals with colistin to prevent infections and this bad practice generated bacterial strains resistant to this antibiotic that were passed to humans Colistin was treated to treat all the infectious diseases in China and after a while all the bacteria became resistant it is unknown

7. A scientist wants to study the kinetics of a specific membrane protein. They ligate the DNA coding region of the protein to the DNA coding region for GFP and introduce the DNA into cells. A day or two later, they observe the cells under the microscope and they are fluorescing green. They then shine a laser at a region of the cell repeatedly (or continuously) that region loses its fluorescence. They monitor a separate region of the cell and find that fluorescence never decreases in that area. What is the full name of the technique that they performed? What can they conclude from their result? a) What is the full name of the technique that they performed? Flurorescence recovery after photobleaching (FRAP). b) What can they conclude from their result? Membrane proteins show lateral movement in the membrane. Due to this movement of proteins, fluorescenc appears in the region of photobleaching. c) List another photobleaching technique and briefly indicate how it is different from the technique described here. The other technique in FLIP (Fluorescence Loss in photobleaching) is a fluoresecne microscopy technique used to examine movement of molecules inside cells and membranes. A cell membrane is typically labelled with a flurescent dye to allow for observation. The major difference between these two microscopy techniques issthat FRAP involves the study of a cell's ability to recover after a single phtovleaching event whereas FLIP involves study of how the loss of fluorescence spreads throughout the cell after multiple phtobleaching events. d) When or why might photoactivation techniques be preferred over photobleaching techniques?

Protein X is a transcriptional repressor. If the DNA binding domain for Protein X was replaced with a different DNA binding domain, what would most likely occur? The new protein would cause transcriptional repression at different genes. The new protein would not function. The new protein would cause transcriptional activation at different genes. The new protein would cause transcriptional repression at the same genes.

Which of the following would cause Drosophila cells to behave as they would at night? A chemical that increases the polyubiquitination of Tim. A chemical that decreases the expression of Tim. A chemical that prevents the degradation of Tim. A chemical that increases the degradation of Tim.

A scientist studying NTF2 starts to consistently add excess miRNA targeting NTF2 mRNA into a eukaryotic cell. What will eventually occur? Nuclear import will decrease, and nuclear export will decrease. Nuclear import will function normally, and nuclear export will decrease. Nuclear import will function normally, and nuclear export will function normally. Nuclear import will decrease, and nuclear export will function normally.