The Living World Questions and Answers

All of the following are at risk effects of youth who are detained and confined in juvenile institutions EXCEPT Poor occupational outcomes Mental Health Problems Poor educational outcomes Less likely to be rearrested or confined

Can you send me a primary research article about protein synthesis and how it relates to brain function 1 What was the major goal and motivation of the study 2 What are the major findings of the paper and how were these achieved 3 How did the study advance the field 4 What new questions does the study potentially raise in terms of future research directions

The diagram below shows the transport functions of four types of lipoproteins For example one type of lipoprotein transports triacylglycerols TAGS from the liver to the peripheral tissues Identify the type of lipoprotein associated with each Drag the appropriate labels to their respective targets View Available Hint s VLDL IDL HDL LDL VLDL remnants TAGS to peripheral tissues V liver cholesterol from dead or dying cells 11 cholesterol to peripheral tissues Reset Help

33 Examine the longitudinal section of a male cone under 4x provided here Label the scales microsporophylls pollen sac microsporangia and pollen grains You may need to export the picture to an app that allows picture editing functions PPT Word etc Be sure to include a figure title labels and notes longitudinal section whole male cone close up of microsporangia Ve

X Definition Sentence Word Parentheses Facts and or Chara Pictur

3 Characterize the function of meiosis in sexual reproduction

18 Distinguish between proto oncogenes and tumor suppressor

17 Outline the role of growth factors in driving Cellular Proliferation

16 Characterize the role of the anaphase promoting complex in mitosis

Explain how pedigree analysis can be used to predict the chances of the disease being inherited by a child Evaluate the advantages and disadvantages of using pedigree analysis when parents are considering having a child when there is an inherited condition in their own families

13 Understand the production of two identical daughter cells by mitosis

12 Compare cytokinesis in plants and animals

O 7 Contrast replicated and nonreplicated Chromosomes

O 0 8 Describe the eukaryotic cell cycle

3 Memorize the number of chromosomes and the ploidy in a human karyotype

Define septation and its role during binary fission

Fully utilizing ceorgia state services resume writing Graduate counseling seeking out research opportunities relevant to veterinary medicine strengthen r sum por veterinary school Anica wosprod Plan to volunteer as AWARE wadipe rehabilitation center professional Development Improving myselp through learning and training to advance in my career seeking out leadership opportunities at csu restorative I enjoy bringing animais back to good health I love to solve problems by identipying undermining Pactors eradicate them and restoring things back to their true giory I want to specialize in rehabilitation as a veterinarian soft skills Top 3 skills I exhibit according to clipton strengths Assessment Harmony My 1 Skill I plan to heavily utilize this skill to help resolve the many congues that arise in this procession I Experience Additional opportunities outside of school to strengthen resume por vet school Becoming A veterinarian summer internship 2023 consistency Balance is very important to me Everyone and everything should be treated equally in regards to this propession in order to maintain harmony Bachelors op science begree 2024 Education pursing multiple degrees in biology Animal biology exams Assignments Necessary to broaden my knowledge and skills necessary to become a veterinarian Animal biology laboratory exams surengthen r sum Por veterinary schoo Masters op science degree 2025 zoo biology research Meerkas viglian so primary com vs earth sones CPton strengths assessment

Please match the first part of the sentence about Civil War Technology with the most accurate statement In terms of communication the Civil War was different because instead of messengers they communicated through Doctors during the Civil War invented new dietetic system to The Ironclad CSS Virginia travelled at a speed of Smooth bore muskets had an effective range of less than By the end of the Civil War there were over 1 000 If Confederate soldiers captured Spencer Rifles they could not be used because A Gatling gun could fire Gatling guns were revolutionary because while other barrels fired The large bullets during the Civil War Unlike earlier muskets Spencer Rifles could be fired in less than Earthworks and fortification were essential during the Civil War because The benefit of the new Minie ball bullet was that The Ironclad CSS Virginia was outfitted with the telegraph 6 knots the telegraph 100 yards 200 rounds per minute

1 Describe the process of binary fission

Needed Safety ding JBA Data Science Skills Online Learning Coursera Class Central Science Communication Certifications Outside of GSU inituencing and Relationship Building Mentors Weaknesses Resources Skill Gap At GSU Resume Career Services Grad Strategic Thinking Clifton Strengths Professional INTJ A Current Experience Self Assessment Shark Researcher recommendation Write personal J statement Publish primary research Obtain Bachelors Degree Short Term Long Term Narrow down research focus Work towards PhD Present at STEM conference PhD in Marine Biology Find faculty in shark research Lab Safety programa Research Professional Organizations Coding Certifications SCUBA Join a Professional Organization

What is the significance of the quotation taken from the following passage taken from the essay Petrarch s Plague The year of 1348 left us alone and hopeless Petrarch declared at the very beginning of his Familiar Letters OIt shows the severity of the Plague O It shows that the year of 1348 was good O It shows the significant events of 1348 O It has no supporting information

Have balance To avoid a biased article research contradicting evidence and determine how if you will present the information Evaluate the credibility and quality of the science Contact experts Ask scientists about their findings and their field Reach out to other scientists to fact check information Don t overstate or overexaggerate findings Don t mislead with statistics When using percentages don t inflate the significance of the figure Write simply and clearly General readers aren t scientific experts so simplify scientific terminology and concepts

Hook reader from the beginning Organize your ideas with an outline Look for most newsworthy facts and interesting quotes Use inverted pyramid story structure Newswriting format that summarizes the most important facts at beginning of story Begin with the lead a sentence that summarizes the key informati of the story Add paragraphs in the order of relevance and importance Use words general readers can understand Explain scientific or technical terms if these words are needed Use transitions between paragraphs

HOOK the beginning Organize your ideas with an outline Look for most newsworthy facts and interesting quotes Use inverted pyramid story structure Newswriting format that summarizes the most important facts at beginning of story D Begin with the lead a sentence that summarizes the key information of the story Add paragraphs in the order of relevance and importance Use words general readers can understand Explain scientific or technical terms if these words are needed Use transitions between paragraphs phrases that keep the story flowing and let the reader kno

The inhibitors of the electron transport chain are substances that bind to some of the components and block the passage of electrons at different points in the chain This inhibition results in the accumulation of reduced forms before the inhibition point whe the inhibitor blocks the flow of electron and oxidized forms of the components of the electron transport chain behind the inhibition point Recall that reduction is gain of electrons whereas oxidation is loss of electrons When a component of the electron transport chain accepts an electron it gets reduced and when it transfers its electrons to an acceptor it gets oxidized and the acceptor becomes reduced For example in the following reaction coenzyme Q is in the oxidized form and accepts an electron to be in the reduced form If we were to add a drug that blocks electron transfer at this step coenzyme Q would remain oxidized and FADH would remai reduced Drag the appropriate labels to their respective targets View Available Hint s Identify the complexes and mobile electron carriers that remain reduced and oxidized due to the following blocker inhibitors You can use the electron transport chain labeled in part A to help answer this question Complex IIl Cytochrome c Complex 1 Coenzyme Q Complex IV Inhibitor Blocker FADH Reduced form Amytal is a painkiller that blocks the flow of electrons to Coenzyme Q Cyanide is a poison that blocks the flow of electrons to oxygen Complex IV Antimycin is an antibiotic that blocks the flow of electrons to Cytochrome c Rotenone is an insecticide that blocks the flow of CoQ FAD CoQH Oxidized form Oxidized form Reduced form Last component that can be Last component that remains reduced due to inhibitor blocker axidized due to inhibitor blocker Reset Help

Select the electron carriers involved in the electron transport chain Check all that apply View Available Hint s flavin mononucleotide cytochrome C glyceraldehyde 3 phosphate glucose iron sulfur clusters phosphate

Label the steps of electron transport leading to oxidative phosphorylation where ATP is synthesized from ADP using the energy stored by the electron transport chain Drag the appropriate labels to their respective targets View Available Hint s Proton flow is accompanied by electron transfer into the intermembrane space Protons return to the matrix through a proton specific channel Protons release potential energy which drives the phosphorylation of ADP to ATP Electron flow is accompanied by proton transfer into the intermembrane space Electron transfer into the matrix releases potential energy which drives phosphorylation of ADP Electrons from oxidizable substrates pass through the electron transport chain A proton concentration gradient is established Reset Help

v 1 V 2 V 3 4 V 5 6 7 8 V 9 Heredity Genes for a trait Segregation of alleles 2 Physical form 6 1 copy of each gene Heredity 2 copies of each gene 8 A Phenotype B Genotype C Diploid D Mendel s first law E Dominant F Allele G Homozygous H Recessive 1 Haploid J Heterozygous Same Expressed in heterozygote Form of a gene 3 4 Expression Different Hidden in 10 heterozygote

Can you please send me a primary research article about protein synthesis involved in creating the traits of a human being

e ragworm provided here Identify the coelom status of this organism is e pseudocoelomate or coelomate

Original DNA Strand TTACAAJAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 6 Red blood cells have a protein called hemoglobin that carries oxygen A mutation to the hemoglobin gene causes the disease sickle cell anemia Below is the portion of the hemoglobin gene where the mutation is found For each strand of DNA write the mRNA sequence circle the mRNA codons and write the amino acid sequence Normal hemoglobin DNA T ACCACCTGGACTGAGGACTCCTC mRNA Strand Amino Acid Sequence Mutated hemoglobin DNA resulting in sickle cell TACCACC TGGACTGAGGACAC CTC mRNA Strand Amino Acid Sequence What is the difference between the normal hemoglobin protein and the sickle cell hemoglobin protein What specific kind of mutation causes sickle cell anemia

Instructions Using the case study below write a concise APA paper using bullet points Include an APA style Title page 3 8 Concise and PRECISE BULLET POINTS FOR EACH SECTION At least one in text citation an APA style Reference page You may use your textbook and other current textbooks Include one PEER REVIEWED reference De not that ends withog com edu or gov se the following four Level 1 headings within your paper Pathophysiology of the Disorder Etiology of the Disorder A B is experiencing Clinical manifestations of the Disorder A B is experiencing Expected Treatment Options for A B Based on the pathophysiology of the disorder and clinical manifestations on peer reviewed references Nothing A 21 year old female A B presents to the urgent care clinic with symptoms of nausea vomiting diarrhea and a fever for 3 days She states that she has Type I diabetes and has not been managing her blood sugars since she s been ill She is unable to keep anything down She only tolerates sips of water and juices Since she s been unable to eat she hasn t taken any long or rapid acting insulin as directed While helping A B from the lobby to the examining room you note that she s unsteady on her feet her skin is warm and flushed and she s drowsy You also note that she s breathing rapidly and her breath has a sweet fruity odor A B has a challenge answering questions but keeps asking for water to drink You get more information from A B and learn the following She had some readings on her glucometer which were reading high She vomits almost every time she takes in fluid She hasn t voided for a day but she voided a great deal yesterday She s been sleeping long hours and finally woke up this morning and decided to seek care Current labs and vital signs BP 88 46 HR 132 BPM RR 28 min deep Temperature 101 3 F

itehsh Interphase The cell can grew then this means they will grow its DNA B Whitefish Late Prophase Using 40x Objective Lens The spindles begin to capture making them able to organize the chromosomes C Whitefish Metaphase Using 40x Objective Lens The chromosomes will start to condense each and then after that get coiled D Whitefish Late Anaphase Using 40x Objective Lens

binds before the elongation factor tRNA small ribosomal subunit large ribosomal subunit large ribosomal subunit small ribosomal subunit elongation factor mRNA Question 2 1 point Listen Which of the following structures contains the receptor protein importin Nucleolus Nucleus Saved O Chloroplast

The energy needed to polymerize DNA is supplied by the hydrolysis of the phosphate bonds of the deoxynucleoside triphosphates that are being added to the new DNA chain the hydrolysis of the RNA primers used in DNA replication the hydrolysis of the phosphate bonds of ATP the hydrolysis of the phosphate bonds of ATP or GTP

Multiple sites of DNA replication along eukaryotic chromosomes are known as O promotors ARS elements replicons

In DNA replication the leading strand of DNA forming strand called the lagging strand while the other newly is synthesized in a series of short discontinuous fragments the new DNA is synthesized as a continuous chain does not require an RNA primer an RNA primer is required is synthesized as a continuous chain the new DNA is formed in a series of short discontinuous fragments is synthesized in the 3 5 direction the new DNA is synthesized in the 5 3 direction

Which of the following statements best describes the termination of transcription in bacteria RNA polymerase transcribes through an intron which causes the polymerase to let go of the transcript RNA polymerase transcribes through the terminator sequence causing the polymerase to separate from the DNA and release the transcript Once transcription has initiated RNA polymerase transcribes until it reaches the end of the chromosome ORNA polymerase transcribes an RNA that cleaves the pre mRNA

An example of nucleic acid hybridization techniques Protein quantification O Fractionation Gel electrophoresis

Nuclear export signals NES are recognized by Nucleoporins Importin O Exportin

Which of the following structures contains the receptor protein importin Nucleolus Nucleus Chloroplast Mitochondrion

During initiation of translation in both eukaryotes and prokaryotes the binds before the elongation factor tRNA small ribosomal subunit large ribosomal subunit large ribosomal subunit small ribosomal subunit elongation factor mRNA

Use your DNA replication diagram to answer the following Leading strand Lagging strand Okazaki segments Ligase Helicase old template TCGACC Choose Choose Discontinuous synthesis Binds adjacent nucleotides Breaks hydrogen bonds to open the double strand new strand AGCTGG Formed on lagging strand Breaks phosphodiester bonds to open the double strand Continuous synthesis new strand AGCUGG Choose

9 Compare and contrast demand pull and cost push inflation

7 Discuss how the economy adjusts back to equilibrium in response to changes in AD and AS in both the short and long run i e a negative positive shock on AD and a negative positive shock on AS

6 Explain why the long run aggregate supply LRAS curve is vertical

2 Discuss why the aggregate demand curve slopes downward

What happens to proteins made in the

12 Consider this question If the mass of the car is kept constant how will increasing the applied force affect the distance the car travels Write a hypothesis based on this question 2 points 13 Identify the dependent variable independent variable and constant for this experiment 2 points Already done for you independent variable the applied force dependent variable the distance the car moves

Body temperature C Posture 35 30 6 5 4 3 2 1 0 22 Three toed sloths Bradypus variegatus are placental mammals that live in trees in Central and South America They eat leaves and fruit and get almost all their water from succulent plants 22 Three toed sloths change their body posture in response to the temperature of their environment ambient temperature Researchers assessed posture on a scale from 1 to 6 with 1 being when the sloth was curled into a tight ball and 6 when it had all limbs spread The percentage of time the sloths were observed in each position was recorded at ambient temperatures from 22 C to 34 C The researchers also measured the body temperature of the sloths over the same range of ambient temperatures 100 6543 2 1 24 0 100 24 3 2 1 26 28 30 Ambient temperature C 0 100 6 5 4 3 1 2 1 1 0 100 6 5 4 3 2 1 0 100 32 T 26 30 28 Ambient temperature C 5 4 13 0 2 0 2 1 1 0 0 100 32 exstri 4 34 100 34