The Living World Questions and Answers

he scattergraph shows the genome sizes of four Enterococcus species Genome size bp 0 2x 106 4 x 106 Key E columbae O E faecium O E faecalis E pallens What can be concluded about the 6x 106 genomes in Enterococcus A E pallens has the greatest number of genes B E faecalis and E faecium have the same mean number of genes C The total genetic information in Enterococcus is constant within each species D E pallens has more DNA than E columbae

FITB 1 pt Using the E value method calculate the quantity of NaCl in g required to prepare the following prescription Rx Proparacaine HCI Benzalkonium Chloride Sodium Chloride Sterile Water Make isoton soln Answers 1 1 1 1 0 02 qs Answer 1 g Round to 3 significant figures qs 150 mL

Y Part A Which structures are highlighted Dorsal roots of spinal cord Submit Previous Answers Request Answer

Anterior roots of spinal nerves are functionally

B A Identify the structure labeled G C D E F E F G H

12 13 14 8 11 15 10 Labeling Activity 1 1 2 9 3 5 17 16 18 31 area 30 29 28 area 27 area 26 22 19 23 24 21 25 20 1 2 3 4 5 6 7 22 23 24 25 26 27 28 29 30 31 8 9 10 11 12 13 14 15 16 17 18 19 20 21 liver

The end of a linear chromosome is shown below DNA The hTERC the human Telomere RNA component that resides within the human telomeric protein oval hTR is also depicted Combined the hTR and the hTERC comprise the ribonucleo protein that is Telomerase 1 Name a gene that if inactivated could lead to immortalization of cells and how would accomplish that 2 Name a gene that if over activated could lead to the immortalization of cells and how would accomplish that 3 Redraw the linear chromosome with two additional telomeric repeated added to it Please underline bold color the new additions differently form the sequence and differently from each other so it can be differentiated from the existing sequence 3 hTERC 5 GGTTAGGGTTAGGGTTAG 3 3 CCAAT 5

Describe each ART ELEMENT that you see in the artwork Start with the most prominent element and how that element is primarily used in the artwork Provide specific examples and include as many as you can For full credit answer at least 4 of the following questions with a minimum of one complete sentence each Elaborate on your answers as necessary for a thorough description 1 LINES Do you see lines What kind of lines Vertical horizontal curved straight thick thin long short etc 2 SHAPES Do you see shapes What kind of Shapes Circular square triangular biomorphic shapes of specific objects etc 3 TEXTURE Do you seek texture What kind of texture Rough shiny wood skin water dots stripes etc 4 VALUES Light and Dark Do you see lights and darks What do they look like Light dark medium high contrast blended etc 5 COLORS Do you see color Bright dull red yellow blue black white etc Section 3 Design Qualities 25 points

Which steps of the citric acid cycle correspond to each stage Drag the appropriate items to their respective bins step 1 step 2 The first stage step 3 step 4 step 5 step 6 The second stage Reset He step 7 step 8

What differences in the pendulum s swing speed motion and energy do you notice when the pendulum s mass in increased

What were the differences in the pendulum s swing speed and total energy between the 45 and the 90 swing

As the pendulum swings towards the lowest part of its swing explain how energy is transferred What type of energy is it losing and gaining

ble 4 Mitosis in Cancerous Chicken Stomach Cells Total of of Cell Cells Cycle Phase of Mitosis Interphase Prophase Metaphase Anaphase Telophase TOTAL 424 50 12 3 11 500 100 Time min 448 min

change across elevation Does the relative size of the head change across elevation Hypothesis Body shape in the genus Pristimantis changes across elevation i e across environmental temperature gradient Predictions limbs and head in species living at high elevations tend to be shorter than those living a low elevation Insert two figures scatter plots and a brief summary below SVL mm 50 40 30 OZ 0 65 Tibia length SVL 0 45 0 55 0 35 0 7 0 6 Foot length SVL 0 5 0 0 4 0 3 Q 0 0 0 0 0 Fig 4 SVL vs Elevational Midpoint in 147 species of Prisimantis 20 000 O 1000 o 68 1000 008 00 00g 2000 800 Elev midpoint m 2000 3000 Elev midpoint m 3000 ooo O O O Fig 5 Tibial Length SVL vs Elevational Midpoint in 147 species of Prisimanti 00 4000 O 4000

change across elevation Does the relative size of the appendages change across elevation Does the relative size of the head change across elevation Hypothesis Body shape in the genus Phrynopus changes across elevation i e across environmental temperature gradient Predictions limbs and head in species living at high elevations tend to be shorter than those living a low elevation Insert two figures scatter plots and a brief summary below SVL mm 40 35 30 Foot length SVL 25 20 15 0 50 0 55 0 45 Tibia length SVL 0 30 0 35 0 40 Fig 1 SVL vs Elevation Midpoint in 32 species of Phrynopus 0 50 0 45 0 0 40 O 0 35 3000 O O O O 3000 00 Fig 2 Tibia length SVL Elevational midpoint in 32 species of Phrynopus O 3000 3500 Elev midpoint m O B O O 3500 Elev midpoint m 4000 3500 Elev midpoint m 4000 4000 Fig 3 Foot length SVL Elevational midpoint in 32 species of Phrynopus

Finding the consensus C The coding strands sequences below represent promoter regions of several genes of the bacterium Generalus geneticus Based on the following sequences what is the average distance in bases between the 35 and Pribnow boxes Round your answer to the first place after the decimal point 40 35 30 25 20 15 10 5 1 GCGCTTTAATAGCATAGCTGTCTCCGT TTTGATCAGGTT AAA CTTCATTGGTAACCCCACTGCATCGACC TAATACTATCAA AGC GACCGTAGATCACACGACCAGTTCGGGGGTATGAAGAGAATTGAA TAGACCTGATTTATGAATCCCAGAGAAC GAGAATGGACAA ACC AGGCCTTGATTGGCGGAACCGGGACT TATGATGCGGGGCACA GAAGGTTGAGAAGATTCGGAGGGCTCAT TATGAACACAGGCCCG CCACCTTGATAACGACACGTACGGGCCG CATGATTGGCGC ACC AGCCATTGATATGAGATCAGACAGCCGCGTAATGTTCACCGGAGA ACCAAATGATAAAAAAGTCAACCAGAC TATGATAACGAATATC ACCCATCGATAACAGGTAAAACGCCCCC TATGATATAGGGCACT

lack 3 5 proofreading exonuclease activity use nucleoside triphosphates as substrates produce an antiparallel complementary strand to the template synthesize nucleic acids in the direction 3 5 evolutionary well conserved RNA polymerase DNA polymerase Both enzymes DNA polymerase DNA polymerase Neither enzyme

A B The following are four different potential outcomes for the Meselson Stahl experiment Please match the outcome on the left with an interpretation i e the model compatible with it Please note that in reality only one result is correct and one result is improbable A ONA Density Generation LIH 1 C C DNA Density Generation LIH 1 2 3 2 3 B DNA Density Generation LIH 1 2 3 D DNA Density Generation LIH 1 2 3 Conservative replication Semiconservative replication Improbable

Copper Number method Arrow method Nobel Gas method Arrow Number Thorium Nobel Gas Arrow Number Nobel Gas

Explain define the role of both afferent and efferent signals in regulating the clock

Question 6 Points 2 Based on the tax and spend label given to liberal Democrats how did John F Kennedy seem to break that mold He proposed to cut taxes O He proposed to cut taxes and raise defense spending O He proposed to cut taxes and cut welfare programs He proposed to cut welfare programs and raise defense spending

What is eukayotic initiation and what are the steps involved in it

Why are introns considered beneficial if they are are spliced out of the RNA transcript

How do introns contribute to the complexity and diversity of gene expression and protein synthesis

write 1 take home message about the professional patent The take home message must be followed by an explanation short essay on how that take home message may help you advance your career plans

1 Joachim is at a party with his friends Some of his friends are being inconsiderate and disrespectful by bullying a new kid from their neighborhood who is also at the party Joachim expresses his disapproval to the bullies in a passive way Juanita expresses her disapproval to the bullies in an aggressive way Lucy expresses her disapproval to the bullies in an assertive way Give an example of how Joachim Juanita and Lucy would respond in their various forms of communication Whose response is MOST likely to be effective and why 2 Brody recently found out that Martin is dating his ex girlfriend and is livid Cornering him in a hallway in between classes Brody screams at Martin Where do you think you get off dating my ex I m furious What are three different ways Martin could use conflict resolution techniques to respond in this situation What is most likely the BEST of all of Martin s three options and why Explain how this same BEST option could apply in other situations when conflict is involved 3 JJ tells his friend Anna that he is thinking of joining a street gang Why might JJ feel like this is a good choice for him If JJ joins the gang what is likely to be expected of him What gang behaviors would likely put his health at risk What are some things Anna can say to JJ that might encourage him to think differently about his choice What can Anna s community do to discourage gangs from forming in the first place 4 Jamie is talking to her dad about the homelessness issue in their city Her dad tells her there wouldn t be a problem if these people would just get jobs Jamie disagrees with her dad s statement How might Jamie respond in a way that informs her dad about who makes up the homeless population and why people become homeless What are three action steps Jamie and her family might take to make a difference in her city s homeless population 5 Chen is worried that his friend Leo is drinking alcohol every day after school What are the best ways for Chen to offer assistance to Leo If you were in Leo s situation and were beginning to worry about your own unhealthy choices how would you ask someone to help you Why would you pick this method

Three Proteus vulgaris Two S m and P v will be under the positive glucose fermentation to acid and P p will be under the branch for the negative reaction PR L S m and P v will be under the negative glucose fermentation to acid and P p will be under the branch for the positive reaction Serratia marcescens One Pseudomonas aeruginosa The number of columns gives the number of steps roups alendar Inbox History DD People Office 365 YuJa LAMC Tutoring Welcome Center Library NetTutor When creating a dichotomous key what test can be used to separate these bacilli into two branches If you start with PR G fermentation of glucose into acid how would the names of the bacilli be separated What is the minimum amount of steps needed to separate these three bacilli in a dichotomous key A step is a test Which of these microbes is Choose Choose Choose Proudomonas aeruginosa est

lowing paragraph and table to answer the questions that follow Points for each the data estion are in bold at the end of the question Organisms get energy from the food they eat but the energy contained in foods varies greatly Most foods contain a combination of proteins carbohydrates and fats One gram of protein or carbohydrate such as glucose contains roughly 4 Calories One gram of fat however contains about 9 Calories The table below shows the approximate composition of one serving of some common foods Composition of Some Common Foods Protein g Food Apple 1 medium Bacon 2 slices Chocolate 1 bar Eggs 2 whole 2 milk 1 cup Potato Chips 15 chips Sourdough bread 2 slices Skinless roasted turkey 3 slices 0 5 3 12 8 2 8 11 Carbohydrate g 22 0 23 0 12 14 36 3 Fat g 0 6 13 9 5 10 1 1 17 Per serving which of the foods included in the table has the most protein Which as the most carbohydrates Which has the most fat 4pts 18 Approximately how many more Calories are there in 2 slices of bacon than there are in 3 slices of roasted turkey Why is there a difference 4pts 19 Walking at a moderate pace consumes around 300 Calories per hour At that rate how many minutes would you have to walk to burn the Calories in one chocolate bar Show work Explain your answer 3

B It is common for cancer cells to have lost p53 activity Based on what you know about p53 function and regulation what regulatory mechanisms might be disrupted in p53 that could lead to a cancerous phenotype List two specific examples and explain Bullet point your response for easier grading

Observe the following table of biochemical tests and Gram negative bacilli Answer the questions below by choosing the best answer from the pull down menu Fermentation and Oxidation in Gran Negative Bacilli Serratia marcescens Proteus vulgaris PR PR PR Glucose Lactose Sucrose acid acid acid Pseudomonas putida When creating a dichotomous key what test can be used to separate these bacilli into two 4 2 Choose O F Test FA OA FA

Observe the growth of bacterial colonies on these plates Which dilution factor plates would not be appropriate to use to determine bacterial concentration Why Exercise 5 results 10 105 10 106 104 107

Cells bacterial or eukaryotic are always transcribing and translating all coding DNA regardless of environmental conditions True

The normal DNA sequence is ATC GGC TAA TCC The mutated DNA that shows a frameshift mutation is O ATC GCT AAT CC O ATC GGC TAC TCC

under very different cif the voice and tone of each selection However there are some similarities between the texts as well Review your annotations and notes to find similarities and differences in voice and tone in the two works In a small group discuss how the voice and tone in these two works compare Then work together to complete the chart with examples from each text that illustrate tone or voice In the third column note if you think the examples are similar or different Tone Voice LETTER TO JOHN ADAMS LEAN IN COMMENTS ANALYZE THE TEXTS Discuss these questions in your group 1 Infer Do you think the two women would agree on what makes an ideal marriage Explain using examples from each text 2 Synthesize How do Adams s comments about the approaching revolution suggest that she would have appreciated Sandberg s advice on pursuing success 3 Compare Though the two writers have different styles they have energy and passion in common Use evidence from the texts such as details related to style or tone that demonstrate their energy and passion 4 Evaluate What do these two works suggest about how involved the Pulding Compon

Part 5 Conclusion Analyze the data from your lab to help answer the following question How can abiotic factors affect sea urchins and the kelp forest ecosystem CLAIM EVIDENCE

In our Theory of Knowledge class students discussed their thoughts on the question What is art in a socratic seminar Students came to the consensus that art can mean many things and take on many different forms One student suggested that art is a physical representation of people s emotions According to them art invokes one or more of the senses like touch or taste Another student suggested that art is characterized by its usage of artistic elements like form and texture A third student suggested that art can also be a form of political protest They provided the example of a fashion show where everything the artists wore broke to demonstrate the ills of fast fashion I think that all three student s views basically encompass the essence of art I think that art can be defined by its purpose as well as the tools used to create it The conversation veered onto the topic of art s value One student suggested that humans value art based on how much we can interpret it Therefore professional artists can interpret things better compared to a regular person Another student disagreed with this arguing that art s value is not conditional on the person viewing it and that art has inherent value I personally agree with the second student An art piece s message doesn t waver depending on the person who views it Art is always subject to human interpretation Human interpretation is subjective but this doesn t disregard the art s value

Over the past 500 million years there have be en mass extinctions and each time at least species on Earth became extinct O twelve 96 O two 25 O seven 25 O seven 25 of the

f all of Earth s history were compressed into 24 hours would first appear less than 10 minutes ago Land plants Animals Paleozoic Multicellular eukaryotes Single celled eukaryotes Meso zoic Ceno zoic Proterozolc Archaean Eo Eon Billions 2 Humans of ago years Atmospheric oxygen Origin of solar system and Earth Prokaryotes

Question 1 O O There are 5 10 20 amino acids that are used by organisms for protein synthesis 0 5 pt

Components O Brown tube Phusion HF buffer Blue tube TPS Green tube RNA forward Pink tube RNA reverse Yellow tube A template Clear tube usion DNA polymerase tal volume of the stock sample 5X 10 mM 10 M 10 M 0 05ng L 2 U L concentration in reaction tube 1X 0 2 mM 0 2 M 0 2 M 0 5ng 100 L 1U 100 L per reaction Positive control L 63 5 L 20 0 L 2 0 L 2 0 L 2 0 L 10 0 L 0 5 L 100 L per reaction Negative control L 73 5 L 20 0 L 2 0 L 2 0 L 2 0 L 0 5 L 100 L

1 Rita has watched as her mom has been diagnosed with two different types of cancer and type 2 diabetes Her mom hasn t eaten well her entire life and hasn t led a very active life Rita wants to try her hardest to avoid diseases and to improve her quality of life How can Rita s relationship with nutrition affect her quality of life and risk for disease What are three specific actions she can take to try to decrease her chances of disease and improve her quality of life 2 Terrance was recently diagnosed with high cholesterol His doctor wants him to make changes to his individual diet plan to help him eat more nutritious foods and fewer empty calories What is the best way for Terrance to make these changes What are three questions he could ask himself to help determine what changes need to be made If you were in Terrance s situation what three changes would you make 3 Kendra wants to lose weight However every night after work it s most convenient for her to stop at a fast food restaurant where she eats a cheeseburger and fries Before going to bed she eats ice cream and potato chips What are some healthier alternatives she could try to help her lose weight What are other ways she can enjoy healthier foods 4 Jamal has found a supplement at his health food store that claims to cause a person to lose 10 pounds a month He asks you if he should take it How would you respond What are some ways you could teach Jamal to critique the validity of health products How will Justin know if this product is safe and effective 5 You notice your friend has been skipping meals lately and appears to be losing a lot of weight How would you respond in this scenario What are two ways you might help your friend make positive health choices

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Where do axons that travel through the posterior root ganglion terminate in the posterior columns O in the anterior horn O in the anterior columns in the posterior horn

What kind of chemical reactions does it involve Ouncatalyzed oxidation Ouncatalyzed hydrolysis enzyme catalyzed hydrolysis enzyme catalyzed oxidation

Where does digestion occur in the body Check all that apply in the stomach in the dodecadactylon in the small intestine in the liver in the large intestine in the mouth

Match each of the following functions with the the graph that best describes the situat a The cost of building a house as a function of its square footage b The height of a rock dropped from a 300 foot building as a function of time c The height of a human as a function of time 1 d The demand for pizza as a function of price e The height of a child on a swing as a function of time m w rz 11 M

3 Consider the diagram below that depicts a transcription bubble Which letter s could represent proper transcripts 3 5 W Y X Z 5 m