Molecular Basis of Inheritance Questions and Answers

2 Write the CODON that corresponds with each amino acid There may be more than one The full names are written but the codon chart only shows the first three letters proline valine histidine 3 A single codon is used to signal the beginning of protein synthesis It is commonly called the START CODON Locate the start codon on the chart What are the three bases of this codon 4 There are three codons that signal the end of synthesis these are called STOP codons What are the three stop codons 5 For each sequence of DNA is shown Write the complementary RNA sequence underneath the letters then use the codon chart to determine the amino acid sequence NATAC CAT GGA ATT ACT RNA Amino Acids glycine phenylalanine arginine DNA RNA Amino Acids TTC AAT GGT CTA GGG

step in this process is called TRANSCRIPTION where a coding region of DNA is converted to messenger RNA mRNA During transcription mRNA is made from the DNA sequence following the base pair rule except RNA does not contain the base Thymine but instead has Uracil The mRNA then leaves the nucleus and goes to a ribosome in the cell s cytoplasm The ribosome reads the message three bases at a time called a CODON Each codon will specify a single amino acid The amino acids are joined together and folded into a protein a process called TRANSLATION Key Points DNA is used to make a copy of mRNA transcription mRNA leaves the nucleus and goes to ribosomes 3 bases codon 1 codon a single amino acid A chain of amino acids a protein Protein synthesis is also called translation Biologists use a codon chart or a codon wheel to determine the amino acids Amino acids are usually abbreviated on these charts as three letter words like Cys and Ser First base in codon U C G UUU UUC UUA UUG CUU CUC CUA CUG AUU UCU UCC UCA UCG CCU CCC CCA CCG ACU AUC lle ACC AUA ACA AUG ACG GUU GCU GUC GCC GUA GCA GUG GCG Phe Leu Leu Met of start Second base in codon C A Val Ser Pro Thr Ala UAU U UAC Tyr C UAA Stop UGA Stop A UAG Stop UGG Trp G CGU CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG His Gin Asn Lys UGU UGC Asp Glu Cys 3 CGC CGA CGG AGU AGC AGA AGG Arg GGU GGC GGA GGG Arg Ser Gly C GUCAG U A G Third base in codon Val Ala Ser G 10 G Arg A Lys Asp A 24 OP GU Asn A Cu Glu UC U C G Gly Phe Leu UA U G C G C Thr GA A A Met Start CU C GU GU A C UG 110 2 PO UA GACGC C 2 A Arg C A A A G C Ser G 2 U 15 UC Gin 2109342 Tyr His PG SONA C So UC G Stop Stop G Trp Stop Cys Pro Leu

5 Mendel s Laws 5 3 Define Mendel s two laws How do we use probability rules to predict the results of genetic crosses 6 Pedigrees 5 3 Diagram simple pedigrees for a dominant trait a recessive trait and a sex linked recessive trait Label with appropriate genotypes 7 Punnett Squares 5 3 Draw Punnett squares for a monohybrid cross a sex linked cross and a dihybrid cross Give the expected phenotype and genotype ratios for each 8 Non Mendelian Genetics 5 4 Not all traits follow Mendelian patterns Explain how this statement applies to a degrees of dominance b multi gene traits c mitochondria and chloroplasts 9 Environmental Effects 5 5 Give an example of how the environment can influence phenotype Define plasticity Pg 56 10 Genetic Disorders 5 6 Make a chart of 3 human genetic disorders their symptoms and their causes Pg 11 Chi Square Analysis Science Practice 5 Statistical Tests and Data Analysis Show an example of a chi square analysis and answer the following questions How is a chi square test carried out What do its results tell you When do you accept the null hypothesis When do you reject it What types of data are suitable for chi square analysis Total 2 5 5 5 5 2 5 5 5 5

Provide the abbreviation of the following nucleotide 01 07 OH OH MP NH d AG C TU DR TR NH

View Available Hint s U G C A 3 5 DNA coding information strand G1 U DNA template strand G1 G1 Synthesis of mRNA G2 G2 T Transcription bubble G2 G2 G G2 RNA polymerase ACT G2 G2 G1 G2 Termination site Reset Help

First step of transcription RNA polymerase identifies the termination sequence mRNA strand and RNA polymerase are released The correct ranking cannot be determined Submit Previous Answers RNA polymerase identifies the start sequence DNA double helix unwinds to expose the nucleotide bases Last step of transcription RNA polymerase adds bases that are complementary to the DNA template Incorrect Try Again 2 attempts remaining The mRNA is the end product of transcription To synthesize the mRNA strand the DNA should unwind to expose the nucleotides and then the enzyme RNA polymerase recognizes and connects with the control segment in DNA to be tr The mRNA is assembled as the RNA polymerase moves down the DNA template adding complementary nucleotides to the growing RNA strand Transcription ends when the RNA polymerase reaches a termination sequence and the ne

Arrange the steps of transcription of DNA to synthesize mRNA Rank the steps of transcription View Available Hint s of DNA to synthesize mRNA To rank items as equivalent overlap them RNA polymerase identifies the start sequence First step of transcription DNA double helix unwinds to expose the nucleotide bases mRNA strand and RNA polymerase are released RNA polymerase identifies the termination sequence RNA polymerase adds bases that are complementary to the DNA template Reset He Last step of transcription

Which of the following genotypes causes Jacobs syndrome O XO XXX O XXY OXYY

the space provided 18 I List in the correct order all of the signals needed during translation to make this transmembrane protein It will not be part of the mitochondrion or chloroplast Use the names of the signals bes olozsv m ng NH COOH CYTOSOL ER LUMEN botalamon riendly Has the ER signal sequence been removed

4 The ruffed chicken has an under chin wattle A smooth wattle S is dominant over a wrinkled wattle s A red wattle HR is incompletely dominant with a white wattle HW so that an individual with HRHW will have a pink wattle A chicken with a wrinkled red wattle is mated to a homozygous chicken with a smooth white wattle What is the genotype and phenotype of the chicks 4 points

3 Pigment in mouse fur is only produced when the C allele is present Individuals of the cc genotype are white If color is present it may be determined by the A a alleles AA or Aa results in agouti color while aa results in black coats What F and F phenotypic ratios are obtained from a cross between AACC and aacc mice What phenomenon is demonstrated in this problem 4 points

6 A paternity case has been filed by a mother with type B blood who has a child with type O blood One potential father has type AB blood another has type A blood both his parents were AB and the third potential father has type A blood one of his parents had AB and one of his parents had A blood Based on this information which man is most likely to be the father 3 points

III O III ON O O ll II SOOSSAS IV H The figure represents a tRNA molecule that recognizes and binds a particular amino acid but it has the same general structu as all other tRNAs Which of the regions labeled in roman numerals I through V corresponds to the anticodon loop V

1 Diabetes has been found to be inherited in many cases through a recessive allele d Two parents who are non diabetic have a diabetic child Write the genotypes of all three persons 2 In corn there are two alleles for the gene for sugar content High sugar content su is recessive to low sugar content Su Give the phenotypes for each of the following individuals Susu susu SuSu 3 Skin color in a fish is inherited via a single gene with four different alleles How many different genotypes would be possible in this system List them 4 Achondroplasia a form of dwarfism is inherited as a dominant condition Two dwarfs both of whom had one parent of normal height marry and plan to a have child Their first child is born and is a dwarf What is the probability that this child is heterozygous

2 How does a geneticist use pedigrees to create genetic crosses to trace the inheritance of traits over generations of families to prove that sex linked traits are caused by codominant allel Oto replicate identical strings of DNA

Why do histones bind tightly to DNA Histones are negatively charged and DNA is positively charged Both histones and DNA are strongly hydrophobic Histones are covalently linked to the DNA Histones are positively charged and DNA is negatively charged

DNA replication is Osemiconservative O conservative Odispersive irregular

3 Describe in what way are changing gene expression affects overall protein levels in the cell and what processes in the expression of genes eventually influence the amounts of proteins

O miRNA Histone modification factors Question 3 Methylation is involved with DNA that does not have coding regions O True O False 10 pts Question 4 20 pts

Question 5 What is DNA methylation Modifications that control DNA transcription typically due to environmental factors 20 pts Recent mutations inherited in the DNA Genomic regions that control the expression of distal genes O Modifications of the N terminal tails of histones during translation

GUU GCU GUC GCC GUA Val GCA Ala GUG GCG GAU GAC GAA GAG AUG Met or Start UAG UAA and UGA Stop Asp Glu This is the normal messenger RNA for MC1R in dogs is Glu Ser Phe Lys Asp Arg protein is too short Ser Gln Glu Leu Arg Lys protein is too long Glu Ser Phe Lys Asp Arg protein is too long GGU GGC GGA GGG Yellow Labrador Retrievers produce this mRNA transcript Gly 5 AGCCAGGAACUUCGAAAG 3 Dept Biol Penn State C2002 5 AGCCAGGAACUUUGAAAG 3 UCAO What is the normal sequence of the polypeptide that is produced and what type of mutation is seen in yellow labs

Rifamycin is an antibiotic used to treat the bacterium that causes tuberculosis It works by binding to the bacterium s RNA polymerase subunit This kills the bacterium by inhibiting transcription translation DNA replication cell division 13

Which characteristic of the genetic code lowers the likelihood of a mutation causing a m phenotype Universality Un ambiguity Non overlapping N

During the process of transcription DNA polymerase adds nucleotides to the newly synthesized strand one DNA strand serves as a template a supply of the nucleotides ACGT is required two new RNA molecules are produced

Which of the following sets of tRNA anticodons would associate with the following mRNA c translation 5 TTA GGT AAA 3 5 UUA GGU AAA 3 5 AAA TGG ATT 3 O5 AAA UGG AUU 3 5 AAU CCA UUU 3

AUG Met or Start UAG UAA and UGA Stop Dept Biol Penn State 2002 The genetic disease sickle cell anemia is due to a mutation in the B globin gene a component of hemoglobin Normal B globin allele template strand 3 TGAGGACTCCTC5 Sickle B globin allele template strand 3 T GAGGACACCTC 5 Which of the following statements best summarizes the sickle cell mutation This is a silent mutation The mutation results in a Leu being replaced by a His O The mutation results in a Glu being replaced by a Val The mutation results in a stop codon appearing in the mRNA too early

Mutation questions Transcribe then translate this normal sequence of DNA all questions below will refer to this sequence 5 GGTATGGCCGCACAATAGTTGC 3 3 CCATACCGGCGTGTTATCAACG 5 I 18 19 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCAUAAUAGUUGC 3 Translate this sequence

5 1 2 4 3 Date What kind of gametes does a person of genotype AaBb produce What kind of gametes does a person of genotype DdEE produce Brown hair is dominant over blonde hair Using the letters B and b write the genotype for the following persons a homozygous brown b heterozygous brown c homozygous blonde A brown eyed man Bb marries a brown eyed woman Bb Blue eyes are recessive a Give the genotypic ratios of the children b Give the phenotypic ratios of the children Hour Two non freckled parents Ff are crossed What proportion of their children could be freckled A brown eyed man Bb or BB married a blue eyed woman bb Their first child is blue eyed What is the man s genotype Explain

Which of the following choices is the method we used to evaluate the effect of UV light exposure on E coli and B subtilis in the lab We divided one NA plate in half and swabbed one culture per side Then exposed it to the UV light We divided one NA plate in half swabbed the entire surface of the agar using the inoculum from a pure culture and exposed only one side to the UV light We turned on the UV light and let the plates sit in the cabinet with lids on We turned on the UV light and let the exposed swabbed areas under the light for different amounts of time True True True True

The poly A tail is added to the RNA transcript in the lumen of the rough endoplasmic reticulum to protect and stabilize the transcript

Occasionally a double stranded DNA molecule contains a uracil base U What is a likely source of the base methylation of a thymine a none cleaved primer base Deamination of a cytosine residue an rUTP is incopoorated during DNA replication

A eukaryotic mutation upstream of a particular gene has been identified that changes the sequence of the TATA box to GATA How would you predict that this mutation would affect the transcription of this gene Transcription factors would bind in the middle of the gene sequence and transcribe the gene from that point Transcription factors would bind to the start point in the promoter region Transcription factor binding would be reduced or eliminated and transcription of the gene would decrease dramatically Transcription would proceed normally

Which of the following processes only occurs in eukaryotic gene expression RNA polymerase binds to the promoter A poly A tail is added to the 3 end of an mRNA and a cap is added to the 5 end Transcription can begin as soon as translation has assembled the first few amino acids in the polypeptide mRNA tRNA and rRNA are transcribed

The codon for phenylalanine is UUU Which of the following codons also most likely encodes for phenylalanine AUC AAA UUC CUC

1 For RNA transcription the nontemplate strand reads 5 ACTGGTTCA What will be the sequence of the resulting transcript for this portion 2 The template strand reads 5 TCATTGCAA what will be the sequence of the resulting transcript for this portion

Question 17 A mutation in the DNA sequence of a gene that codes for a protein is always harmful to the organism impairing the function of the protein cannot be repaired is a very common occurrence happening in about one out of every 100 nucleotides poto producing cell

Question 15 Which of the following sequences of DNA was produced using this strand as a template 5 ACAGTCGAGCCTCGT 3 O 3 TGTCAGCTCGGAGCA 5 3 ACGAGGCTCGACTGT 5 3 ACAGTC CICGL 5 0 5 pts

You are working in a molecular biology lab and isolate a previously unknown virus Analysis of its genome reveals that it is composed of a double stranded DNA molecule containing 14 T thymine Based on this information what would you predict the C cytosine to be 14 28 36 72 Cannot be determined from the information given

Here are four individual strands of DNA 1 5AATTCCGGCCTAACTT3 2 5 AAGTTAGGCCGGAATT3 3 5 TTAAGGCCGGATTGAA3 4 5 TTCAATCCGGCCTTAA3 Which strands would pair with one another O1 and 2 3 and 4 O1 and 4 2 and 3 1 and 3 2 and 4 1 and 3 only

The process of DNA replication is semiconservative This means that a replicated chromosome is composed of two DNA molecules sister chromatids One molecule is composed of two newly synthesized strands of DNA while the template molecule is composed of the two parental strands of DNA two DNA molecules sister chromatids each with one newly synthesized strand of DNA and one parental strand of DNA two DNA molecules sister chromatids Each DNA molecule contains segments of both newly synthesized and parental DNA randomly mixed throughout the molecule one DNA molecule and one RNA molecule sister chromatids

During DNA replication along the lagging strand of DNA Okazaki fragments are produced This is because DNA polymerase can only add new nucleotides to the 5 end of the newly synthesized DNA can only add new nucleotides to the 3 end of the newly synthesized DNA is only active along the leading continuously synthesized strand Primase produces the Okazaki fragments is the enzyme involved in producing the mRNA molecule

1 Define genetic code 2 Ust the STOP codons 3 identify the START codon 4 What is the anticodon of UAG 5 Why are amino acids coded by different codons A 4 Lysine Z Asparagine Z Trp STP cys SR Ser Leucine B Complete transcription and translation Phenylalanine Tryptophan STOP Cysteine Threonine Serine Arg YOTUSOTS Arginine Ger C A U Serine AGC 1 Transcription 2 Translation Genetic Code 4502060204000 G Isoleucir G MH Met C STP AU STOP Methionine CU UA AC Histidine CAG UG Tyrosine Tyr Y O SUGA C OVOSOPCUGACUGACUGACUCCO AU O Cin Glutamine Valine Val CROSOT G Proline P Glycine Pro Arginine SCAO Arg R Aspartic C acid Glutamic acid Leucine GE Alanine P Determine the next six amino acids of the B amyloid protein from the given DNA molecule using the genetic code CTG CCC ATG CTC CAG VC MicrVUI LL P Medina O D E O

Complete the table that compares RNA and DNA Nitrogenous Select bases The unique structure of the sugar ring Number of strands The table compares the DNA and RNA molecules DNA Does it leave the nucleus as a normal process Function Select Select Select Select V V Select Select Select Select Select RNA

omplete transcription translation VGSNKGADOGL EAFFVLKOHHV ABFRHOSO Amyloid beta peptide 1 40 The following DNA template indicates the first 7 base pairs for the beta amyloid protein foun cell membrane of neural cells Complete the double stranded DNA molecule by adding the complementary bases CTA A C CGT CTT A AA TCT CTT Transcription Step DNA is copied into mRNA The DNA strand is copied onto RNA by the enzy polymerase to make the mRNA molecule that will bring the gene information to the RER Not T G C RNA A U G C Translation Step Amino acids are assembled into a protein using the mRNA template tRNA ribosomal subunits Use the Genetic Code A C CTA CGT A AA G TCT G

What are the names of the following RNA molecules Letter I Select Letter G Select Select Select 5 G H What letter points to the tRNA D N IMI AAAUCO GGGUUU C E F D A B C Letter E T 3

MC 1 point Which of the following statements best describes Answers A D A It is defined as minimum sequence of 3 to 6 amino acids that creates a unique site B It is an example of one type of post translational modification c It is a region of the protein characterized by enzymatic activity O Consists of two or more peptides that form a macromolecular protein complex

The lagging strand is synthesized using the 5 3 3 5 1111 DNA strand as a template

Consider the relative map distances between four genes on the chromosome shown here What is the expected recombination frequency between genes X and Z W X Y 2 15 10 5 2 10 Z

2 A strand of DNA 3 A strand of DNA has 27 adenine How much cytosine should it have 4 A strand of DNA has 15 cytosine How much thymine should it have

The following figure shows a regulatory protein being produced on the left Based on the information in the figure this protein must function in which of the following ways Gene encoding a regulatory protein Promoter mRNA Regulatory protein Regulatory Target sequence gene O b mRNA DNA Structural protein or enzyme a In the presence of the end product of the operon this protein will bind to the regulatory region and acts as an activator This protein must influence a hairpin sequence and thus fine tunes the operon c This protein may act as either an activator or repressor d This protein would not have an effect on transcription of the target gene e When glucose binds to it the protein binds to the regulatory sequence and prevents transcription of the target gene