Biomolecules Questions and Answers

Biology
BiomoleculesWhat is xylem a plant cell type that carries out most the metabolic functions of the plant vascular plant tissue mainly consisting of tubular dead cells responsible for conducting water and minerals throughout the plant body a plant cell type that supports the plant body particularly in young plants and which is flexible so as to not restrain future growth vascular plant tissue consisting of living cells that transport sugar and other organic nutrients throughout the plant body a rigid supportive plant cell type which possesses thick secondary walls


Biology
BiomoleculesThe Spanish flu outbreak which lasted from 1918 1919 was one of the most severe pandemics in recent history it is believed to have infected over 500 million and killed over 50 million people worldwide this is more than any other pandemic including COVID 19 This flu was caused by the H1N1 virus and was unusually deadly For the scientific community the outbreak of the Spanish Flu began a race to create a vaccine Vaccines prevent deadly and or dangerous diseases by working with the body s immune system to reduce the risk of infection and develop immunity against the disease One of the leading causes of death for patients infected with the flu was a pneumonia infection in their lungs Due to this a British scientist named Frederick Griffith decided to focus his work on creating a vaccine to prevent pneumonia infections Pneumonia is caused by the bacterium Streptococcus pneumoniae Streptococcus pneumoniae has two forms the S strain and the R strain The S or smooth strain is covered with an outer coat known as a capsule and is highly virulent meaning it is able to cause the disease The R or rough strain has a rough appearance because it lacks a capsule and is therefore nonvirulent meaning it does not cause the disease Griffith was interested in researching ways to manipulate or change the S strain bacteria to alter its virulence Specifically he wanted to heat kill the cells to determine if that would reduce their virulence He planned to inject healthy mice with both the S and R strains What is a possible hypothesis for Frederick Griffith s experiment

Biology
BiomoleculesmRNA amino acids Met Ala Tyr Glu Lev val 2 DNA TACCTGTTAAGCTACAAAATT mRNALAUGEACAADUC GA GUUUGAA Mat A 3 DNA AATACGGG mRNAVU amino acids amino acids amino acids 4 DNA GCTAGTACGTGCACATTAGAA mRNA CGAUCAUGCACGUGUA AUC T A N A A U Valine Arginine c acid Alanine Asparti CGTAACCACTA MUGGUGAN UCAGU CA G GCA scid Agnar Glutamic QC AGU U CA GUCAGO CAGUAGU U Glycine G Phenyl alanine Leucine SU CA GU A C Serine CO Tyrosine UCAGUCA CU CA Stop Cysteine Stop Tryptophan Leucine

Biology
Biomolecules6 In a cross of AABBCC x aabbcc what proportion of the F generation are heterozygous 01 O O O 1 3 O 1 8

Biology
Biomolecules1 4 points Describe the following related to water a 1 pts Describe one thing that is special about the bonds between oxygen and hydrogen in a water molecule that makes hydrogen bonding possible b 3 pts Describe why hydrogen bonding in water important to life

Biology
BiomoleculesIn Chapter 3 we took a look at the biological macromolecules that make life possible This can be an exciting topic that gives students insights into topics such as nutrition and anatomy but it can also be a confusing topic for many students Look over the learning objectives for Chapter 3 and identify an objective topic that either gave you an Aha moment or left you confused even after listening to the lecture reading the materials and working through the homework For this week s discussion post I want you to describe either your Aha moment or muddiest point and then respond to two other classmates You may find that other students inspire you or get you to think about a topic differently You also may find that you can help a classmate with a topic that gives them trouble I will be posting videos each week addressing topics that you identify as your mussiest point DIRECTIONS Compose an initial discussion board post by creating a new thread The initial post should be 200 250 words and should include screen shots or links to the sources claims you reference Be sure to fully address the prompt above Reply to the discussion post of at least two of your classmates Your reply should be at least 100 words and may involve constructive questions additional thoughts insights or further information

Biology
Biomoleculesexplain how synaptic transmission can be modified at the pre and post synaptic side


Biology
Biomoleculesdifferentiate between chemical and electrical synapses differentiate between different glial cell types and explain

Biology
BiomoleculesListen Acid fast bacteria will not be decolorized by a acid alcohol and will therefore retain the carbolfuchsin red dye True False

Biology
BiomoleculesWhich of the following is NOT an enumerated power O Power to make laws O Power to coin Money O Power to set up Banks O Power to raise an Army a Navy O Other

Biology
BiomoleculesWhich of the following is NOT an example of implied powers being used O The creation of national holidays O The creation of the Environmental Protection Agency EPA O The Draft during wartime O Food Stamps O Other


Biology
BiomoleculesBased on the GRAM STAIN virtual lab you completed which circle shown here would contain bacteria B contains bacteria A No answer text provided There are no bacteria present O A contains bacteria B

Biology
Biomolecules2 Streptococcus mutans is one of the bacteria responsible for dental plaque formation ar lacks an outer membrane outside its cell wall Structurally and morphologically how would they look under the microscope Illustrate the appearance